ID: 1089783340

View in Genome Browser
Species Human (GRCh38)
Location 11:120890284-120890306
Sequence CAGCTCATACAGCTTATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089783334_1089783340 16 Left 1089783334 11:120890245-120890267 CCAGATGGAGAAGGTTCAGAGAG 0: 1
1: 0
2: 1
3: 29
4: 322
Right 1089783340 11:120890284-120890306 CAGCTCATACAGCTTATGCATGG 0: 1
1: 0
2: 0
3: 6
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089783340 Original CRISPR CAGCTCATACAGCTTATGCA TGG Intronic
901416797 1:9121990-9122012 CAGGCCATACAGCTGATGCCTGG + Intronic
902350420 1:15849515-15849537 CAGCTCAAGCAGGTTATGAATGG - Intronic
907317087 1:53579414-53579436 CACCTCAGACAGCTTTTGAAAGG + Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
907600784 1:55767278-55767300 CAGCTCTCACAGTTTCTGCATGG - Intergenic
912449348 1:109759762-109759784 CATCTCGAACAGCTTCTGCAAGG + Exonic
913315731 1:117549777-117549799 CAGCTCATACAGGCTAAGTACGG - Intergenic
918111309 1:181457559-181457581 CAGCTCGGACAACTTCTGCAGGG + Intronic
921506639 1:215979132-215979154 CAGGTAAGACAGCTTTTGCAGGG + Intronic
922357093 1:224786709-224786731 AAGCTAAAACAGCTTAGGCAAGG - Intergenic
1067361025 10:45578778-45578800 CAGTTCATGCATTTTATGCAAGG - Intronic
1068158546 10:53233823-53233845 CATCTCAAACAGTGTATGCAAGG - Intergenic
1068822210 10:61390173-61390195 TAGCTCAGACAGCATATTCATGG + Intergenic
1070331353 10:75419740-75419762 CAGCTCAGACAGCATCTCCAAGG - Intergenic
1070634673 10:78115437-78115459 CACCTCAAACAGTTTATGAAAGG + Intergenic
1073616624 10:105003027-105003049 AAGTTCATGCAGCTCATGCATGG + Intronic
1075486547 10:122827064-122827086 CAGCTCAGACAGCAGATACATGG - Intergenic
1080680508 11:34471062-34471084 CAGCACACACAGCCTCTGCATGG - Intronic
1080823854 11:35831495-35831517 AAGCTCCTACAACTCATGCAAGG + Intergenic
1081311518 11:41579740-41579762 GAGTTCATACAGGTTAGGCAGGG + Intergenic
1081411636 11:42765594-42765616 CAGCCAAGACAGCTTGTGCAGGG + Intergenic
1081677087 11:44976613-44976635 GAGGTCACACAGCTTATACATGG + Intergenic
1081687715 11:45054276-45054298 ATGCAAATACAGCTTATGCATGG + Intergenic
1089783340 11:120890284-120890306 CAGCTCATACAGCTTATGCATGG + Intronic
1091311231 11:134576670-134576692 CAGTTCTCACAGCTAATGCATGG - Intergenic
1100084561 12:90893432-90893454 CAGGTCATAATGCTAATGCATGG + Intergenic
1107451316 13:40512673-40512695 CAGCCCCTACTGCTTATGCTGGG - Intergenic
1111414430 13:87920376-87920398 AAGATCATACAGGTTATGAAAGG + Intergenic
1115426512 14:33266668-33266690 AAGGTCATTCAGCTAATGCATGG + Intronic
1117594791 14:57315336-57315358 CTGATCATAGAGCTGATGCAGGG - Intergenic
1118292284 14:64538283-64538305 CATTTCATACAGCTTTTACATGG + Intronic
1118374356 14:65163719-65163741 CAGCTCCTACAGCTTGTGAGAGG + Intergenic
1119179619 14:72596851-72596873 CAGTTCATACAGCTAATACCAGG - Intergenic
1120877763 14:89390752-89390774 CACCTCTTACAGCATCTGCAGGG - Intronic
1121039132 14:90730612-90730634 GAGCTCATCAAGCTCATGCAGGG - Intronic
1123731582 15:23150300-23150322 CAGAGCATACAGCATATGCCAGG + Intergenic
1126040313 15:44584289-44584311 CAGCTCCTCCAGCTTATCCAAGG + Exonic
1133854079 16:9533420-9533442 CAGCTCATTCAGCTCAATCAAGG + Intergenic
1134860297 16:17554742-17554764 CAGGTCACACAGCTGATGAATGG - Intergenic
1135653999 16:24231993-24232015 CAGCTCCTACAGTTTATGTGAGG - Intergenic
1135709722 16:24705224-24705246 CAGATCACACAGTTAATGCATGG + Intergenic
1136278011 16:29191016-29191038 CAGCCCATGCAGCCGATGCAGGG + Intergenic
1139320005 16:66106707-66106729 GTGCTGATACAGCTTCTGCAGGG - Intergenic
1141501453 16:84447221-84447243 CAGCTCAGCCAGCTCATGCCAGG + Intronic
1141825331 16:86475133-86475155 GAGCGCATGCAGCCTATGCAGGG + Intergenic
1141872912 16:86801145-86801167 CAGCTCATTCAGCCACTGCAGGG + Intergenic
1146635453 17:34501015-34501037 AAGCTTAGACAGCTTCTGCAAGG - Intergenic
1147183437 17:38701312-38701334 CAGCTCTTACAGCATTTGCTGGG + Intergenic
1152162032 17:78674870-78674892 CAGCTCACACAGCGCCTGCAGGG + Exonic
1158725507 18:59968250-59968272 CAGATCATGCAGGTTTTGCAAGG + Intergenic
1159322131 18:66866449-66866471 CAGGTAAGACAGCTTGTGCAGGG + Intergenic
1161646114 19:5454534-5454556 GATGTCATACAGCTTATGAATGG + Intergenic
1165416908 19:35700132-35700154 CAGCTCACACAGCTAGTCCATGG - Intergenic
1165708321 19:37991899-37991921 CAGGTCATGCAGCTAGTGCAGGG - Intronic
925215109 2:2087551-2087573 CATCTCATACAGCTTCGGCAAGG + Intronic
927192613 2:20527186-20527208 AAGATCATGCAGCTTCTGCAAGG + Intergenic
929969880 2:46564959-46564981 CAGCTCATGGAGATTATTCAGGG - Intronic
930148887 2:48037668-48037690 CAGCTAATACAGATGATGAAAGG - Intergenic
934701080 2:96440705-96440727 CAGCTGATCCAGCAAATGCAGGG - Intergenic
935872532 2:107466819-107466841 CAGCTCTTACTGCTTCTGAATGG - Intergenic
939169793 2:138681597-138681619 CAGCTCATTCAGCTTAGTCCTGG - Intronic
943380498 2:187139209-187139231 CAGCTCACACAGCTAGTTCATGG + Intergenic
944666233 2:201961756-201961778 CAGCTAATACCTATTATGCAGGG - Intergenic
946769248 2:223071653-223071675 CAGGTAAGACAGCTTGTGCAGGG + Intronic
1170145992 20:13174970-13174992 CAGGCAAGACAGCTTATGCAGGG - Intergenic
1172036960 20:32017971-32017993 CAGCTCCTTCAGCTGCTGCAGGG - Exonic
1172810388 20:37643384-37643406 CAGGTCATACAGTTCATGAATGG - Intergenic
1173277165 20:41595358-41595380 CACCTCATACAGCTTAAGGTGGG + Intronic
1174699066 20:52589650-52589672 CAGCTCTTCCAGCTGATGTAAGG + Intergenic
1176310359 21:5145927-5145949 CAGCTCAGACAGCCGAGGCAGGG + Intronic
1177706490 21:24713061-24713083 AAGTTCATACAGCTTATAGAGGG + Intergenic
1178038842 21:28616401-28616423 TAGCTCATACATTTTAGGCACGG - Intergenic
1179471241 21:41612143-41612165 CACCACATACATGTTATGCATGG + Intergenic
1179846696 21:44116108-44116130 CAGCTCAGACAGCCGAGGCAGGG - Intronic
1180199319 21:46215225-46215247 GTGTTCATACAGCTTCTGCACGG + Exonic
1184262509 22:43327248-43327270 CAGATCACACAGCAAATGCAAGG + Intronic
949375232 3:3381750-3381772 CACCTGATTCAGTTTATGCAGGG + Intergenic
950862918 3:16166058-16166080 AAGCTCTTACAGCCTATGGAGGG + Intergenic
951927709 3:27926587-27926609 AAGCTCATACAGCTGATGAGTGG + Intergenic
953088276 3:39696006-39696028 CAGCTCACAAAACTTAAGCAAGG - Intergenic
953170594 3:40503404-40503426 CAAATCATACACTTTATGCATGG - Intergenic
955194427 3:56791898-56791920 CAGCTCCCTCAGCTAATGCAAGG + Intronic
955470054 3:59277258-59277280 AAGGTCATACAGCTGATGCCTGG - Intergenic
958454347 3:94310542-94310564 CAGATCCCACAGCATATGCATGG - Intergenic
960058371 3:113293371-113293393 AAGCTCTTAGAGCTAATGCATGG - Intronic
960416850 3:117395719-117395741 CAGTTTTTACTGCTTATGCATGG - Intergenic
961026863 3:123565971-123565993 CAGCTCATACAGCTGGTAAATGG - Intronic
961388201 3:126536325-126536347 CAGGTCATAGAGCTTCTGCAGGG - Exonic
964013531 3:151919176-151919198 CAGGTAAAAGAGCTTATGCAGGG - Intergenic
965664966 3:171083462-171083484 CATCTCATACAGATTAAGGAAGG - Intronic
965731006 3:171772658-171772680 CAGCTCATCCAGCTTTCGCTTGG - Intronic
967522302 3:190446968-190446990 CTGCTCTTTCAGCTTTTGCATGG - Intronic
970550058 4:17171338-17171360 AAGGTCATACAGCCAATGCATGG - Intergenic
972424200 4:38917385-38917407 AAAATCATACAGCTTCTGCATGG - Intronic
972596598 4:40535000-40535022 AAGGTCATACAGTTCATGCATGG - Intronic
977347375 4:95834194-95834216 CAGCTCATGCATCTGATTCACGG - Intergenic
978127657 4:105153655-105153677 AAGTTCATACAGCCTATACATGG + Intronic
984001356 4:174250366-174250388 CAGCTTATACATTTTATGGAAGG - Intronic
984596090 4:181669467-181669489 CATGTCATACAGCTTATGTGGGG + Intergenic
987313401 5:16701629-16701651 CCGCTCCTGCAGCTTCTGCAGGG + Exonic
997795074 5:136800921-136800943 CAGCTCTTAAAGCTTTTGCCTGG - Intergenic
999155346 5:149453826-149453848 GAGCTCATATAACTTATCCAAGG + Intergenic
1001855105 5:175004017-175004039 CATCTCATACAACTTCTCCAGGG - Intergenic
1012910691 6:105114241-105114263 AAGCTCATACAGGTTTTACATGG - Intronic
1014461394 6:121700026-121700048 CAGCTAATACTGCTTTTGAAGGG + Intergenic
1017269415 6:152489427-152489449 AAGCTCACAGAGCTAATGCATGG - Intronic
1017386234 6:153887490-153887512 CAGCTTATAAAGTTTATACAAGG - Intergenic
1021423552 7:20472774-20472796 CAGCTGGTACACCTTATGTAGGG - Intergenic
1028291038 7:89065392-89065414 CAGCCCATAGGGCTTCTGCATGG + Intronic
1028452646 7:91003220-91003242 TAGCTGATACATCTGATGCATGG - Intronic
1031291716 7:119946258-119946280 CAGCTTACTCAGCTTATTCAGGG + Intergenic
1034477962 7:151298614-151298636 CCGCTCATCCTGCTTATGAAAGG - Intergenic
1038669347 8:29569981-29570003 CAGGTAAGACAGCTTGTGCAGGG + Intergenic
1044305492 8:90636020-90636042 CAGTTTATGCAGTTTATGCATGG - Intronic
1048323093 8:133417193-133417215 CATCGCATACAGTTTATGAATGG - Intergenic
1050527152 9:6555966-6555988 CAGCTGATAAAGCTGATGCCAGG + Intronic
1055732263 9:79290425-79290447 AAACTCATACAGCTTGTACATGG - Intergenic
1056951418 9:91043408-91043430 CAGCTCTTGCAGCTTATGGGGGG - Intergenic
1059348709 9:113649527-113649549 CCTCTGATACAGCTTATGCATGG + Intergenic
1059856426 9:118403228-118403250 CTGCTCTGACAGCTTATGCAGGG - Intergenic
1189078281 X:37941254-37941276 CACCACATCCAGCTTGTGCAGGG + Intronic
1190507212 X:51137995-51138017 CAGCTCATAATGCAAATGCATGG - Intergenic
1194886254 X:99319186-99319208 CAGGTAAAAGAGCTTATGCAGGG - Intergenic
1195198093 X:102518537-102518559 CAGATCCTAAAGCTTATGTAAGG + Intergenic
1197821908 X:130549967-130549989 AAGGTCATACAGCTTATGAATGG - Intergenic
1200227966 X:154429524-154429546 AAGCTCATACAGCTAATGGGTGG + Intronic