ID: 1089786021

View in Genome Browser
Species Human (GRCh38)
Location 11:120907835-120907857
Sequence CTGGGCAAGCAAAAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089786008_1089786021 23 Left 1089786008 11:120907789-120907811 CCCTTGGGATGTGTGCGCTGGCT 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1089786021 11:120907835-120907857 CTGGGCAAGCAAAAGGTAGAAGG 0: 1
1: 0
2: 2
3: 14
4: 210
1089786009_1089786021 22 Left 1089786009 11:120907790-120907812 CCTTGGGATGTGTGCGCTGGCTT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1089786021 11:120907835-120907857 CTGGGCAAGCAAAAGGTAGAAGG 0: 1
1: 0
2: 2
3: 14
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089786021 Original CRISPR CTGGGCAAGCAAAAGGTAGA AGG Intronic
901180269 1:7336819-7336841 CGGGGCCAGCAACAGGGAGAAGG + Intronic
902954814 1:19918343-19918365 CTGTGCTAGCAAAAGGAAGGAGG - Intergenic
904348568 1:29890246-29890268 AAGGGCAAGCCAGAGGTAGAAGG - Intergenic
906019069 1:42610777-42610799 CTGGGGAAGCAAAAGGCAAGGGG + Intronic
906785331 1:48610723-48610745 CTGGGAAAGTAAAAGTTAGAGGG - Intronic
907732336 1:57079356-57079378 GTGGACAAGCAAAAGGTACTTGG - Intronic
908343198 1:63203972-63203994 CTGGGCAAGAGAAAGAAAGAAGG + Intergenic
908439959 1:64143510-64143532 CTGGAAAAGCAAAAGCTACAGGG + Intronic
909662543 1:78100005-78100027 CTGGGCAATGAAGAGGCAGAGGG + Intronic
910214591 1:84830329-84830351 CAGGGCAAGCCAAAGGGAGGAGG + Intronic
910590124 1:88921239-88921261 CTAGGCAGGAAGAAGGTAGAGGG + Intergenic
911119493 1:94281389-94281411 CTGGGCAAGCACAAGGCAGGAGG + Intergenic
913695399 1:121319950-121319972 CTGTGCAAACAAATGATAGATGG + Intronic
914142164 1:144960110-144960132 CTGTGCAAACAAATGATAGATGG - Intronic
914922399 1:151856403-151856425 CTGGGCAAGCCACAGGCACAGGG - Intergenic
915356616 1:155258913-155258935 CTGGACAAAAAGAAGGTAGAGGG + Exonic
915443674 1:155962310-155962332 CTAGGCAAGCATGAGGTAAATGG - Intronic
915881245 1:159674108-159674130 CTGGAAAAGGAAAATGTAGATGG + Intergenic
916896450 1:169168305-169168327 CTGAGGAAGCATAAGGCAGAAGG - Intronic
919201882 1:194365694-194365716 ATGGGGAAACAAAGGGTAGAAGG - Intergenic
919509646 1:198446193-198446215 CTGAGCAAAAAAAAGGCAGATGG - Intergenic
919720455 1:200828526-200828548 AGGGGAAAGCAAAAGGTAAAGGG - Intronic
919816617 1:201444873-201444895 CTATGCAAGCAAAAGTTTGAAGG + Intergenic
919919111 1:202157876-202157898 CTGTTCTAGAAAAAGGTAGAAGG - Intronic
920482730 1:206338329-206338351 CTGTGCAAACAAATGATAGATGG + Intronic
921334919 1:214076332-214076354 CTGGGAAAGGAAGAGGAAGAAGG + Intergenic
922150187 1:222995185-222995207 ATGGGAAAGAAAAAGGAAGATGG - Intronic
923180558 1:231514568-231514590 CTGGGGACTCCAAAGGTAGAAGG - Intergenic
923806028 1:237258956-237258978 CTGGCCAAGCAGAAGGCAGAAGG - Intronic
1064959928 10:20952562-20952584 CTGGAAAGGCAACAGGTAGAGGG + Intronic
1065464346 10:26002827-26002849 TTGGGCAAGCAGAAGTTAGCTGG - Intronic
1067303691 10:45037978-45038000 CAGGGCAAACAAAAGATACAGGG - Intergenic
1069048172 10:63764738-63764760 AAGGGCAAGCCAGAGGTAGAAGG + Intergenic
1070970803 10:80565676-80565698 ATGGGGAGGCAAAAGATAGAAGG - Intronic
1071111338 10:82161069-82161091 CTGGGAAAGAACAAGGTATAGGG + Intronic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072540411 10:96394202-96394224 CTGGGCAAGCACAAGTTGTAGGG + Intronic
1072660090 10:97358609-97358631 CTGGGCAAGCAGAAAGCAAAAGG - Exonic
1073026440 10:100490212-100490234 CTGGGCATGCCATGGGTAGAGGG + Exonic
1073265768 10:102227604-102227626 CCTGGCAAGCAGAAGGCAGAGGG - Exonic
1074565374 10:114572922-114572944 CTGGGCATGCAACAGGTAAAGGG - Intronic
1075231735 10:120685703-120685725 GTGGGCAGGGAAGAGGTAGAGGG - Intergenic
1075698793 10:124455071-124455093 ATGGGCAAGGAAAATGGAGACGG + Intergenic
1078354458 11:10623770-10623792 CTGAGCAGGAAAAAGGTAGGTGG - Exonic
1080162137 11:29189717-29189739 CTGGGCAATGAAAATGTAGAAGG + Intergenic
1080651310 11:34224754-34224776 CTGGGCATACAAAAGACAGAAGG + Intronic
1081585403 11:44380526-44380548 CTGTGCAAGGTAAAGGGAGAGGG + Intergenic
1081689135 11:45064419-45064441 CTGGCCTAGAAAAAGGTAGTGGG + Intergenic
1082589065 11:54982682-54982704 CTGGGGAAAAAAAAGCTAGAAGG + Intergenic
1083746964 11:64742222-64742244 CTGGGCAAGCAGGAGGTGGGCGG - Intronic
1089786021 11:120907835-120907857 CTGGGCAAGCAAAAGGTAGAAGG + Intronic
1090981302 11:131724885-131724907 CTGGGCAAGGAAAAGGCAGCAGG + Intronic
1091044631 11:132314722-132314744 CTGGGCAAGAAGAGGGGAGAGGG + Intronic
1091449676 12:564733-564755 CTGGGCATGCTGAAGGTTGAGGG - Intronic
1091892861 12:4074555-4074577 GAGGGCAAGCAAAAGGTAACTGG - Intergenic
1092119749 12:6035582-6035604 ATGGCCAAGGAAAAGGGAGAAGG + Intronic
1092288666 12:7145158-7145180 CTGGGCATGAAAAAGATAGCAGG - Intronic
1093173854 12:15888951-15888973 GTGGGCAATAAAATGGTAGAGGG - Intronic
1094424508 12:30304512-30304534 CTGCGCAACCACAAGGGAGAGGG + Intergenic
1094642843 12:32293076-32293098 CTGGGCAAGCCACAGGGATAAGG - Intronic
1096814117 12:54190969-54190991 CTGGGCAAGCAAGTGACAGAGGG - Intergenic
1097391378 12:59019007-59019029 CTGCGCAAGCAGAAGGCACATGG + Intergenic
1100337795 12:93648462-93648484 CTGGACAAGGAAAAGATAAAGGG - Intergenic
1102057532 12:109907852-109907874 ATGGGAAAGCACAAGGCAGATGG - Intronic
1102883786 12:116506681-116506703 AAGGGCAAGCCAGAGGTAGAAGG - Intergenic
1108588707 13:51893438-51893460 CTGGTGAAGCTAAAGGAAGAGGG - Intergenic
1108830823 13:54476139-54476161 CTGGGCAAGCAGAAAGAAAAAGG - Intergenic
1112776979 13:102854976-102854998 CTGGGAAAGGAAGAGGTGGAGGG - Intronic
1113039860 13:106092741-106092763 CTGTGAAAGAATAAGGTAGAGGG - Intergenic
1117149028 14:52866532-52866554 ATAGGCAAGGAAAAGTTAGAGGG - Intronic
1117448301 14:55826391-55826413 CTGGGAAATCAAAAGGTTGGAGG - Intergenic
1121046311 14:90790859-90790881 CTGGGCTGGCAAAAAGCAGAGGG + Intronic
1125261193 15:37826895-37826917 CTAAGCAAGCAAAAAATAGAAGG + Intergenic
1127784392 15:62343117-62343139 CTGGGGGAGCACAAGGGAGAAGG + Intergenic
1128733195 15:70034554-70034576 CTGTGCTACCACAAGGTAGAAGG + Intergenic
1129539925 15:76341108-76341130 CGGGGCAAGCAGAAGGCAGTAGG - Intronic
1130322071 15:82849904-82849926 CTGGCCAAGCAAAAGGGAGAAGG + Intronic
1130843810 15:87725728-87725750 CTGGCTCAGCAAATGGTAGAGGG - Intergenic
1131858403 15:96624866-96624888 CAGGGCATGCAAAAGGAACATGG + Intergenic
1132097237 15:98996727-98996749 CTGGGCAAGCAGAAGGTAAAGGG - Intronic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1134634070 16:15778905-15778927 GTGGGCAAGCAGGAGGCAGATGG + Intronic
1135480525 16:22817289-22817311 CTGGTCAAGCAATGGGGAGAGGG - Intronic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1137463475 16:48686894-48686916 CTGGGCAGGGAAGAGGTAGGTGG + Intergenic
1138470752 16:57233889-57233911 CTGGGGAGGAACAAGGTAGAGGG - Intronic
1142359190 16:89618883-89618905 CTCCGGAAGCCAAAGGTAGAGGG - Intronic
1142781959 17:2188249-2188271 TTAGGCAGGCAAAAGGAAGAGGG + Intronic
1143065588 17:4244688-4244710 CTGAGGAAGCAAAGGGGAGATGG - Intronic
1143487400 17:7262344-7262366 CTAGGCAAACAAAAGGTGGAGGG + Exonic
1144163333 17:12582602-12582624 CTGGGCAAGGACAGGGAAGAAGG - Intergenic
1145061387 17:19736449-19736471 CTGGGCAAGCGGAAGTTAGTGGG + Intergenic
1145803718 17:27711429-27711451 TTGGGCAAGCAAAAGGCATCAGG - Intergenic
1146153245 17:30495926-30495948 CTAGGCAAGCAAAAGGCATCAGG - Intronic
1148453264 17:47794958-47794980 CTGGGCAACAGAAAGGTTGATGG + Intergenic
1148714175 17:49704011-49704033 CTGGGCAACTAACAGCTAGAGGG + Intronic
1149478010 17:56979464-56979486 CTGGGAAAAAAAAAAGTAGAGGG - Intronic
1150510813 17:65751051-65751073 AGGGGCAAGGAAAAGGGAGAGGG + Intronic
1150986980 17:70209406-70209428 CTGGGCAACCGAAAGATATAAGG - Intergenic
1153635155 18:7107037-7107059 ATGAGCAAGCAGAACGTAGATGG + Intronic
1153705356 18:7739556-7739578 ATGGGAAAGCAAAAGGAAAATGG - Intronic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1156638966 18:39066832-39066854 CTGTGCCAGAAAAAGGTACAAGG + Intergenic
1156930080 18:42630984-42631006 CAGGGCAAGTAAAAAGTTGAAGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1160355886 18:78228195-78228217 CTGGGCAAGGCAAAGGAAGGCGG + Intergenic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
925005651 2:441185-441207 CAGGGCAAGAAAACGGGAGAAGG - Intergenic
925182931 2:1828530-1828552 CTGGACAGGCAACAGGGAGAAGG - Intronic
925459051 2:4044202-4044224 CAGTGTAAGCAAGAGGTAGAAGG + Intergenic
926724118 2:15984255-15984277 CTGGAGAAGCAAGAGGGAGAAGG - Intergenic
926746346 2:16161511-16161533 CTGGGCCACCAAAAGCTGGAAGG + Intergenic
927486000 2:23488856-23488878 GGGGGTAAGCAAGAGGTAGATGG - Intronic
929131245 2:38574962-38574984 CTGTACAAGCAAATGGTAGGTGG - Intronic
929318763 2:40514289-40514311 CTGGGAAGGAAAAAGGTGGAAGG - Intronic
930196123 2:48512205-48512227 CTGGGCAAGCAGAAGGATTATGG - Intronic
931765595 2:65453269-65453291 CTGGGAAGGAAGAAGGTAGAAGG + Intergenic
935495140 2:103771542-103771564 CTGGGAGAGCAAAACATAGAAGG + Intergenic
936610912 2:114001196-114001218 CTAGGCAAGAAAAAGGTGAAAGG + Intergenic
937890457 2:126934637-126934659 CTGTGCAAGCAAAGGGGAAAAGG + Intergenic
939547617 2:143572414-143572436 CAGGGCAAGGGAAAGGGAGAGGG - Intronic
940460832 2:153960384-153960406 AAGGGCAAGCCAGAGGTAGAAGG + Intronic
942758668 2:179372290-179372312 CTGGGAAATCAAAAGGGAGTTGG + Intergenic
945241055 2:207677478-207677500 CTGGTCAAGGAAAAGGGAAAAGG - Intergenic
946949910 2:224862668-224862690 CTGCCCAAGCAAAAGGCATACGG + Exonic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
1172330593 20:34073796-34073818 CTGGGGAAACAAAGGGGAGAGGG - Intronic
1173732884 20:45340751-45340773 CTGGGCAAGCCAAATTTAGTGGG + Intronic
1175343818 20:58254821-58254843 CTGGGCATGCACAGGGGAGATGG + Intergenic
1176899444 21:14421084-14421106 CTGAGCTACCAAAAGCTAGAGGG - Intergenic
1177301630 21:19252977-19252999 CTAGGATAGCAAAAGGTAGGAGG - Intergenic
1179094440 21:38299686-38299708 CTGAGCAACCAACAGGAAGATGG - Exonic
1179323448 21:40315889-40315911 ATTGGCAAGCAAAAGGAGGAGGG + Intronic
1181827229 22:25527100-25527122 CTGGGCAGGCAAGTGGGAGAAGG - Intergenic
1182342730 22:29637064-29637086 CTGGGCAAGCAGAAGTTACCAGG + Intronic
1185132124 22:49045186-49045208 CTCGACAAGAAAAAGGAAGAGGG - Intergenic
950346357 3:12297595-12297617 CTAGGCAAGTAAAATGTACAGGG - Intronic
950876187 3:16276680-16276702 CGGGGCCAGCAAAAGGTGCAAGG + Intronic
950896852 3:16460483-16460505 CTGGGCAAGCAAAGTGAAGTGGG + Intronic
952808034 3:37375545-37375567 CTAGCCAAGCAAAGGGTAAAAGG - Intergenic
953227558 3:41034365-41034387 CTGTGAAAGATAAAGGTAGAGGG - Intergenic
953981416 3:47415023-47415045 CTGAGAAAGCAATGGGTAGACGG + Intronic
957500489 3:81051268-81051290 CTGAGCAAGAACATGGTAGAAGG - Intergenic
959750078 3:109824006-109824028 GTGGGTAAGCAAGAGGTTGATGG - Intergenic
960003060 3:112752807-112752829 CTGGCCAAGCAATGGGTAAAAGG - Intronic
960254688 3:115499353-115499375 CAGGGCAAGGAAAAGGCAGTGGG + Intergenic
960902515 3:122566334-122566356 CAGGGCAAGCAAGGGGAAGATGG + Intronic
964137183 3:153357345-153357367 TTGGTCAAGCAAAGGGTACATGG + Intergenic
964322550 3:155513373-155513395 CAGTGAAAGCAAAAGATAGAAGG + Intronic
964692779 3:159470928-159470950 CTGGAAAAGGCAAAGGTAGAGGG + Intronic
964876490 3:161373107-161373129 CAGAGGAAGCTAAAGGTAGATGG + Intergenic
964998183 3:162914589-162914611 CTGGCCAAACACAAGGTAGCTGG - Intergenic
966318130 3:178671607-178671629 CTGGTCAGTCAAAAGGTTGAGGG + Intronic
966982126 3:185147102-185147124 CTGTCACAGCAAAAGGTAGATGG - Intronic
970125854 4:12809823-12809845 CTTTGCAAGGAAAGGGTAGAAGG + Intergenic
970559793 4:17271356-17271378 CTGGGCAAGCAACCTGGAGATGG - Intergenic
971418259 4:26453263-26453285 CTCGGGAAGCAACAGGTATAGGG - Intergenic
971677625 4:29654028-29654050 GTGGGCTAGCAGAAGGGAGAGGG + Intergenic
974004692 4:56544288-56544310 CTGGGCAAGGAAAACGTATTGGG - Intronic
974036425 4:56821873-56821895 CTGGGAAGGAGAAAGGTAGAAGG + Intergenic
975546667 4:75567631-75567653 AAGGGCAAGCCAGAGGTAGAAGG + Intergenic
975861886 4:78686167-78686189 CTGGGCAAGCAAATGACAGAGGG + Intergenic
977293724 4:95190642-95190664 CTTTGCAAGGAAAAGTTAGAGGG - Intronic
979808205 4:125001657-125001679 TTGGGGAGGCAAAAGGAAGATGG + Intergenic
984951269 4:185009477-185009499 GCGGGCATGCAAAAGGGAGAAGG + Intergenic
986421299 5:7586653-7586675 CTGGGCAAGCTAAAGACAGCCGG - Intronic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
990478363 5:56184142-56184164 ATGGGCAAGCAAAAGGGTGAGGG - Intronic
990807497 5:59681933-59681955 ATGGGCAAGAAATAGGGAGAAGG - Intronic
996523333 5:124451097-124451119 AGGGGTAATCAAAAGGTAGATGG - Intergenic
998819927 5:146049118-146049140 CTGGACCTGCAAAAGGGAGAAGG + Exonic
999953569 5:156676292-156676314 CTGGGCCAGCAACAGGTTGCAGG - Intronic
1001771537 5:174300731-174300753 CTAGGAGTGCAAAAGGTAGAGGG - Intergenic
1003630771 6:7784832-7784854 CTGTGCAATCCCAAGGTAGAAGG - Intronic
1004403919 6:15313922-15313944 ATGGGCCAGCAGAAGGTATAAGG - Intronic
1004984698 6:21068032-21068054 CTGGTAAACCAACAGGTAGATGG - Intronic
1005497453 6:26400574-26400596 CTGGGGAGGAAAAAGGGAGAGGG + Intergenic
1006565295 6:34950853-34950875 CTGGGCAGGTGAAAGATAGAAGG + Intronic
1007249569 6:40486535-40486557 CTGGGTAAGGAATGGGTAGAGGG + Intronic
1007361189 6:41357408-41357430 TGGGATAAGCAAAAGGTAGATGG + Intergenic
1008335130 6:50294575-50294597 GTAGGCAAACAAAAGGTAGTTGG + Intergenic
1008464464 6:51815052-51815074 CTTGGCAAACAAAGGGTGGATGG - Intronic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1012412990 6:98980910-98980932 CTAGTCAGGCAAAAGGGAGAGGG - Intergenic
1012964225 6:105656135-105656157 CTGGGCAATGAAAGGGTAGCTGG - Intergenic
1013117175 6:107112470-107112492 CTGGGCATGGAGAAGGTAGGCGG + Intronic
1013650797 6:112192684-112192706 CAAGGCAAGCAAAGGCTAGATGG - Intronic
1014056136 6:117016934-117016956 CTTGGCAAGCCACATGTAGAAGG + Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016967167 6:149729630-149729652 CTGGGAAAACAAAAGGTAATAGG - Intronic
1017579063 6:155840735-155840757 ATGGGCAAGCAAAAAGTAAAAGG + Intergenic
1017849044 6:158287224-158287246 CTGGCCACGCAAATGCTAGATGG - Intronic
1018918577 6:168154697-168154719 GTGGGCATGCACAAGGCAGAAGG + Intergenic
1020577731 7:9955454-9955476 CTGGGGAAAGAAAAGGGAGAAGG + Intergenic
1020746348 7:12083337-12083359 ATTCGCAAGCAAAAGGTAAAGGG + Intergenic
1025061309 7:55810941-55810963 CTGTACAAGGAAAAGGCAGAAGG - Intronic
1026127615 7:67593418-67593440 CTGGTCACCCAGAAGGTAGAAGG + Intergenic
1032124792 7:129185573-129185595 CTGGCCTAGCAAAGGGTAGCAGG - Intergenic
1032518326 7:132523457-132523479 CTTGGCAAGGAAAAGGCAGAAGG + Intronic
1032581246 7:133105361-133105383 CTGAGCTAGGAAAAGATAGATGG + Intergenic
1032842507 7:135725494-135725516 TTGGGCAAGAAAAAGGGGGAAGG + Intronic
1036608047 8:10325053-10325075 CTGGCCTAGCAAGAGGCAGATGG + Intronic
1037755480 8:21707334-21707356 TTGGGAAAGGAACAGGTAGAAGG + Intronic
1039313275 8:36343370-36343392 ATGGGCAGGCAAAAGGGAAATGG + Intergenic
1039502186 8:38027007-38027029 CTGCTCTAGAAAAAGGTAGAGGG + Intergenic
1044312151 8:90706286-90706308 CTGAATAGGCAAAAGGTAGAAGG - Intronic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1048888589 8:138928659-138928681 CTGGGCAAGGCAGGGGTAGAAGG + Intergenic
1049736694 8:144211391-144211413 CTGGGTAAGCAAATGGTACCTGG - Intronic
1052403009 9:28024626-28024648 CTAGGCAAGCATAAGGCAGTTGG - Intronic
1052409663 9:28106652-28106674 CTGGGCAAGAAAATGGTGGGTGG - Intronic
1055355157 9:75429877-75429899 CTGGGATAGGAAAAGGCAGAGGG + Intergenic
1058829719 9:108805233-108805255 CTGGGCAAGCCTAATGTAAAAGG - Intergenic
1061607843 9:131724900-131724922 ATGGGTAAGCACAAGGCAGATGG - Intronic
1061700575 9:132412030-132412052 CGGGGGAAGCAAAAGGAAAAAGG - Intronic
1189148844 X:38684052-38684074 AAGGGCAAGAAAAAGGTCGAGGG - Intronic
1189153994 X:38736802-38736824 CTGGGCAACAAAAACGTGGAAGG + Intergenic
1190210641 X:48443921-48443943 CTGGGGAAGGGAAAGGCAGAGGG + Intergenic
1190449773 X:50567149-50567171 CTGGTCATGTAAAAGGGAGAGGG + Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1193437787 X:81499648-81499670 CTGGCTATGCAAAAGGTGGAGGG + Intergenic
1197960336 X:131998047-131998069 CTGGGCTAGCAATATGTAGTAGG + Intergenic
1198092873 X:133349265-133349287 CGGAGAAAGCAAAAGGAAGAAGG + Intronic
1198193562 X:134336332-134336354 GAGGGCATGCAAAAGGGAGAGGG + Intergenic
1201747474 Y:17394325-17394347 CTGGGCTAGCAATATGTAGTAGG + Intergenic