ID: 1089787426

View in Genome Browser
Species Human (GRCh38)
Location 11:120918057-120918079
Sequence CTCATCTCTGCTGTGTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 316}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089787426_1089787438 28 Left 1089787426 11:120918057-120918079 CCCAGCCACACAGCAGAGATGAG 0: 1
1: 0
2: 6
3: 46
4: 316
Right 1089787438 11:120918108-120918130 CAGACTCTGGTCTGAGACCAGGG 0: 1
1: 0
2: 2
3: 24
4: 511
1089787426_1089787430 -9 Left 1089787426 11:120918057-120918079 CCCAGCCACACAGCAGAGATGAG 0: 1
1: 0
2: 6
3: 46
4: 316
Right 1089787430 11:120918071-120918093 AGAGATGAGGATGTTACCTGTGG 0: 1
1: 0
2: 2
3: 18
4: 242
1089787426_1089787431 -8 Left 1089787426 11:120918057-120918079 CCCAGCCACACAGCAGAGATGAG 0: 1
1: 0
2: 6
3: 46
4: 316
Right 1089787431 11:120918072-120918094 GAGATGAGGATGTTACCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 198
1089787426_1089787437 27 Left 1089787426 11:120918057-120918079 CCCAGCCACACAGCAGAGATGAG 0: 1
1: 0
2: 6
3: 46
4: 316
Right 1089787437 11:120918107-120918129 CCAGACTCTGGTCTGAGACCAGG 0: 1
1: 0
2: 0
3: 24
4: 347
1089787426_1089787434 15 Left 1089787426 11:120918057-120918079 CCCAGCCACACAGCAGAGATGAG 0: 1
1: 0
2: 6
3: 46
4: 316
Right 1089787434 11:120918095-120918117 CTTGGCCAGACACCAGACTCTGG 0: 1
1: 0
2: 3
3: 14
4: 160
1089787426_1089787432 -3 Left 1089787426 11:120918057-120918079 CCCAGCCACACAGCAGAGATGAG 0: 1
1: 0
2: 6
3: 46
4: 316
Right 1089787432 11:120918077-120918099 GAGGATGTTACCTGTGGGCTTGG 0: 1
1: 0
2: 0
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089787426 Original CRISPR CTCATCTCTGCTGTGTGGCT GGG (reversed) Intronic
900668167 1:3830240-3830262 TTCATCCCTGCTGTGCGTCTCGG + Intronic
900853502 1:5162462-5162484 ATCCACTCTGCTGTGTGCCTGGG - Intergenic
904294262 1:29507518-29507540 CTCATCTCCACTGTGGGTCTTGG + Intergenic
904446457 1:30576833-30576855 CCCATCTCAGCTCTGTGGGTCGG + Intergenic
904595869 1:31644923-31644945 CTCGTCTCGGCTTTGGGGCTGGG + Intergenic
904811006 1:33163561-33163583 CTCCTTTCAGCTCTGTGGCTGGG + Intronic
905602575 1:39266693-39266715 CTGCTTTCTGCTGTGTGGCCTGG + Intronic
906786380 1:48619577-48619599 GTCATCTTTGCTATGTGACTCGG - Intronic
906886155 1:49651028-49651050 CTTGTCTGTGCTGTGTTGCTAGG - Intronic
907150779 1:52285387-52285409 CTCACCTCTGCTGTGTGGCCTGG - Intronic
908088106 1:60658312-60658334 CTCCTCTCTTCTCTGTTGCTGGG - Intergenic
908411945 1:63875385-63875407 CTTAGCTCTGCTGTGTGTTTTGG + Intronic
910263553 1:85314584-85314606 TTCTTCTCTGCTCTCTGGCTGGG + Intergenic
911994351 1:104745451-104745473 CTCATATCTGCTGAATGGCCAGG - Intergenic
913230751 1:116739036-116739058 GTCCTCTCTGCTTTGTGGGTGGG + Intergenic
914854233 1:151338951-151338973 TTTATCTCTGCTCTGTGGATAGG - Intergenic
915364650 1:155308175-155308197 CTCAGCCCTCCTGAGTGGCTGGG + Intergenic
915567175 1:156721688-156721710 CTCAGCTCTGATGTGTGGTAGGG + Intergenic
916356158 1:163910672-163910694 CCCATCTCTCCTGAGTAGCTGGG - Intergenic
917513538 1:175688167-175688189 CTCAGCTCTGCTGAGTGCCAAGG + Intronic
917619619 1:176782808-176782830 CTAATCTTTGCTGACTGGCTGGG + Intronic
918141801 1:181726043-181726065 GCCATCTCTGCTTTGTGTCTAGG + Exonic
919028621 1:192209779-192209801 CTCAGCTCCCCTGTGTAGCTGGG + Intergenic
919742484 1:200989312-200989334 CTCAGCTCCGCTTTGTGTCTGGG - Intronic
919817420 1:201450322-201450344 AAAATCTCTGCTGTGTGGCCTGG - Intergenic
920676678 1:208043019-208043041 TGCATCCCTGCTGGGTGGCTGGG + Intronic
920710927 1:208294217-208294239 CTGAGCTCTGCTGTATGGCAAGG + Intergenic
921568677 1:216752006-216752028 ATCATCCTTGCTCTGTGGCTTGG + Intronic
922569084 1:226622641-226622663 CTGATGTCCTCTGTGTGGCTGGG - Intergenic
1063763950 10:9115794-9115816 CATCTCTCTGCTGTTTGGCTTGG - Intergenic
1064371936 10:14759739-14759761 CTCACCTCTGCTGTGCAGGTTGG + Intronic
1064486101 10:15792199-15792221 CTCAGCTCTGGTGTGTGACTTGG - Intronic
1065494078 10:26311360-26311382 CCCATCTCTCCTGAGTAGCTGGG - Intergenic
1065646291 10:27837261-27837283 CTCATCTAAGATGTGTGGCCAGG - Intronic
1066318328 10:34272612-34272634 CTCACCTCAGCTGGGTGGCTGGG - Intronic
1069869913 10:71526840-71526862 CCCATCTCTGCTCTGTGACGTGG - Intronic
1070325373 10:75385245-75385267 CACCCCTCTTCTGTGTGGCTGGG + Intergenic
1070370535 10:75778033-75778055 TTCATCTCTACTCTGGGGCTAGG - Intronic
1070737091 10:78870573-78870595 CTCATCTTTCCTGTGTGGCCTGG + Intergenic
1070985777 10:80688569-80688591 CTCAGCCCTGCTGAGTAGCTGGG + Intergenic
1071145411 10:82564518-82564540 CTCCTCTCTGATATGTGGTTGGG + Intronic
1072810016 10:98454340-98454362 CTTTTCTCTGCTGTGTGCATAGG + Intergenic
1075275641 10:121090214-121090236 CTCCTCGCTCCTCTGTGGCTTGG + Intergenic
1075277181 10:121104703-121104725 CTCACCTCTATTGTCTGGCTGGG - Intergenic
1075931825 10:126303684-126303706 CTCAAAGCTGCTCTGTGGCTAGG - Intronic
1075995216 10:126871543-126871565 CCCAGCTTTGCTGTCTGGCTTGG + Intergenic
1076252278 10:128994247-128994269 GACATCTGTGCAGTGTGGCTGGG + Intergenic
1076575665 10:131465032-131465054 GCCATCTCTGCCGTGTGGCCAGG - Intergenic
1076872134 10:133199351-133199373 CTGATCTCGGCTGGGGGGCTGGG - Intronic
1077025101 11:436595-436617 CTCACCCCTGCTCTGTGGCCCGG - Intronic
1077304696 11:1863883-1863905 GTCAACTCTGCAGTCTGGCTGGG + Intronic
1077546823 11:3175436-3175458 CTCAGCTCTGCTCTGTTCCTTGG + Intergenic
1077783966 11:5362518-5362540 TTCATCTCTGCTCTCTGACTAGG - Intronic
1077996057 11:7453633-7453655 CTCCTTTGTGCTGGGTGGCTGGG + Intronic
1078375822 11:10792377-10792399 CTGCGCTCTGCTCTGTGGCTCGG + Intergenic
1078857853 11:15221092-15221114 CTCTTCCTTGCTGTGTGACTTGG - Intronic
1079200188 11:18370474-18370496 CTCCTGTCTCCTGAGTGGCTGGG - Intergenic
1079648955 11:22902294-22902316 CTAATCTCTACTTTGTGACTTGG + Intergenic
1079922067 11:26445503-26445525 CTCATCACTTTTGTGTGTCTCGG + Intronic
1080117166 11:28634059-28634081 CTCTTCCCTGCTGTATGCCTGGG + Intergenic
1080363281 11:31542220-31542242 CTCTTCTTTGCACTGTGGCTTGG - Intronic
1080451343 11:32381307-32381329 CTCCTCTCTGCAGTGAGGCAGGG + Intergenic
1080752005 11:35159307-35159329 CTCACTTCTGAGGTGTGGCTGGG - Intronic
1081337058 11:41879855-41879877 TTCATCTCTGCTGTGTAAGTAGG + Intergenic
1082616708 11:55370353-55370375 CTCATCTCTGCATCATGGCTTGG - Intergenic
1082626491 11:55493575-55493597 CTCATCTCTGCATCATGGCTTGG - Intergenic
1082897984 11:58213481-58213503 CTCAGATCTGATGTGTAGCTTGG + Intergenic
1085137742 11:74108846-74108868 CTAATCTCTGCTGTTTGTCATGG - Intronic
1085577779 11:77622581-77622603 CTAATCTCTCCAGTGTGGCTTGG + Exonic
1085602682 11:77869427-77869449 CTCAGCTCTCCTGAGTAGCTGGG + Intronic
1086432777 11:86751533-86751555 CTCTTCTCTGCAGTGTGGGCAGG - Intergenic
1088576569 11:111277865-111277887 TTCAGCTCTGTGGTGTGGCTGGG - Intronic
1089460754 11:118652068-118652090 CTCTTCCCAGCTGTGTGGCTAGG - Intronic
1089588424 11:119524476-119524498 CTCACCACTGGTGTATGGCTTGG - Intergenic
1089787426 11:120918057-120918079 CTCATCTCTGCTGTGTGGCTGGG - Intronic
1089980459 11:122767696-122767718 GTCCTCTGTGCTGTGTGGCTTGG - Intronic
1090113534 11:123941968-123941990 CTCATCTAGGCTGTGGTGCTAGG - Intergenic
1090802386 11:130181020-130181042 CTCATCCCTGCTGGGTGGGATGG + Intronic
1091641832 12:2243009-2243031 CTTTTATCTGCTGTGTGGTTTGG + Intronic
1096241856 12:49963886-49963908 CTCTTCTCTGCTCTGAGGTTGGG - Intronic
1096430458 12:51538807-51538829 CACATATCTGGTGTGTTGCTGGG + Intergenic
1097629449 12:62042223-62042245 CTCAACTCTGCTCAGTGTCTAGG + Intronic
1097642292 12:62196963-62196985 CTCACCCCTGCTGTGAGGCTGGG - Intronic
1098440922 12:70517308-70517330 GGCATCTCTTCTGTGTGGCCTGG - Exonic
1100090395 12:90961337-90961359 CTCTTCTCTGATTTGTGACTTGG + Intergenic
1100853942 12:98741591-98741613 CTCATGTCACCTGTATGGCTTGG + Intronic
1100854855 12:98749760-98749782 CTGATCTCTGCTGTGTGGGGAGG + Intronic
1102017967 12:109660970-109660992 GTCATGGCTGCTGAGTGGCTAGG - Intergenic
1102430360 12:112878288-112878310 CTCATCTATGCTTGGTGGGTTGG - Intronic
1103271423 12:119676800-119676822 TTCACCTCTGCTGTGGGGATGGG + Intronic
1103452798 12:121041184-121041206 CTCAAGTGTGCTGTGTGCCTTGG + Intergenic
1103594266 12:122014084-122014106 CACAACTCTGCTAAGTGGCTGGG + Intergenic
1103763807 12:123268438-123268460 CTCCTCTATGCTGTGTGCCCTGG - Intronic
1104434870 12:128747825-128747847 CTCCTCTCCTCTGTGAGGCTGGG + Intergenic
1104619292 12:130298773-130298795 CTCATCTCTTCTGAGTGCCAGGG + Intergenic
1105067715 12:133215350-133215372 GTTACCTCTGCTGTGTGGCCTGG - Intergenic
1105882854 13:24618685-24618707 GGAAGCTCTGCTGTGTGGCTGGG + Intergenic
1106135081 13:26967841-26967863 CTCATCACATCTGTGTTGCTGGG - Intergenic
1106218536 13:27724776-27724798 CTATTCTCTGCTGTGTAGCCAGG - Intergenic
1107203601 13:37753523-37753545 CTCATCTTTCCTGTCTGGCAGGG - Intronic
1110224076 13:73101538-73101560 CTGGACTCTGATGTGTGGCTGGG + Intergenic
1112651877 13:101408446-101408468 ATGTTCTCTGCTGTGTTGCTGGG - Intronic
1114625191 14:24124298-24124320 ATCACCTCTGCTCTGAGGCTGGG + Exonic
1114678273 14:24460180-24460202 ATCATCTCTGCTGTGCGGAGGGG - Intergenic
1115308175 14:31953129-31953151 CTCAGCTCTGCTGTGGGTCTGGG - Intergenic
1116056645 14:39872432-39872454 TTCAGTTCTGCTGTGTGGTTTGG + Intergenic
1116763899 14:49047628-49047650 CTTGTCTCTGCTGTGTGCATTGG - Intergenic
1117070472 14:52051414-52051436 CCCAGCTCTGCTATGTGGTTTGG - Intronic
1117311781 14:54532950-54532972 CCCATCTCTGCTGAGTTTCTTGG + Intronic
1121317113 14:92968856-92968878 CTCATCCTAGCAGTGTGGCTGGG - Intronic
1121813847 14:96914195-96914217 CTCATCTCTCCAGGGTGGCTGGG - Intronic
1121830323 14:97045885-97045907 CACATCTCTGATGTGTGGTCAGG + Intergenic
1121956082 14:98214743-98214765 ATCCTCTCTGCTGTGTGTGTTGG + Intergenic
1122403469 14:101481513-101481535 GACATCCCTGATGTGTGGCTTGG + Intergenic
1122699974 14:103581817-103581839 GTCCTGTCTGCCGTGTGGCTAGG + Intronic
1123767995 15:23500848-23500870 ATCATCTATGCTGTGTGGAGGGG - Intergenic
1124937031 15:34183201-34183223 CTCCTCTCAGCTGTGTGGGCTGG + Intronic
1126164259 15:45640780-45640802 TTCATCCCTGTTGTGTGACTGGG + Intronic
1126799858 15:52288915-52288937 CTCATCTCACCTGTGTGCCTTGG - Intronic
1128557596 15:68642256-68642278 CCCAACCCTGCTGTGTGACTTGG - Intronic
1129327286 15:74807522-74807544 CCCATCTCTGTTGTGTTGCTTGG - Intergenic
1129413483 15:75362220-75362242 CTCATCCCCGCTGTGTGGCAGGG - Intronic
1129703840 15:77783375-77783397 CTCACCTCTCCCGTCTGGCTTGG - Intronic
1129714008 15:77836512-77836534 CTCCTCACTGCTGAGGGGCTTGG - Intergenic
1129753263 15:78080617-78080639 CTCATCTGTGCTGGGTGACCAGG - Intronic
1133181445 16:4057823-4057845 CTCATCTCTGAAGTGGGGCTGGG - Intronic
1133812094 16:9168491-9168513 CTCATCCCTCCTGAGTAGCTGGG - Intergenic
1135587503 16:23682008-23682030 CTCATGTCTGGGTTGTGGCTGGG + Intronic
1136574386 16:31114821-31114843 TTCATATCTGCTGTTTGGCAGGG - Intergenic
1137610734 16:49815528-49815550 CTCCTGTTTGCTGTGTGACTTGG - Intronic
1138367976 16:56498816-56498838 ATCATGTCTGCTGTGGGGCCAGG - Intronic
1139091014 16:63647572-63647594 CTCTTCTCTGCTTTATGGCTTGG + Intergenic
1140832680 16:78766037-78766059 CTCATGTCATCTGTGTGCCTGGG - Intronic
1140967741 16:79983497-79983519 CTCAGCCCTCCTGTGTAGCTGGG - Intergenic
1141665981 16:85465311-85465333 CGCATCTCTGCTTGGTGCCTGGG + Intergenic
1141665996 16:85465399-85465421 TTCATTACTGCTGTGTGACTTGG + Intergenic
1141815937 16:86409258-86409280 CACACATCTGCTGTGTGGATGGG - Intergenic
1141829486 16:86501757-86501779 CTCATGTCAGCTCTGTGGATGGG + Intergenic
1142314436 16:89334687-89334709 CTCATCCCTGGGGTGTGCCTGGG - Intronic
1142484232 17:236377-236399 CTCAGCTCTGCTCTGGGTCTGGG + Intronic
1143966872 17:10761845-10761867 CTGATCTCAGCTGGTTGGCTGGG - Intergenic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1145788391 17:27609004-27609026 TTCTTCACTGCTGTGTGGCTTGG + Intronic
1147163364 17:38580219-38580241 CTCCTCTTTCCTCTGTGGCTGGG - Intronic
1147250501 17:39150466-39150488 ATCATCTCTGCTGAGGGGCCAGG + Intronic
1147941898 17:44054682-44054704 CCCATCACTGCTGAGTGGCAGGG - Intronic
1148465859 17:47864930-47864952 CTCATCTCTTGGGTGTGGATAGG - Intergenic
1148678150 17:49457015-49457037 CTCTTCTCTGGGGTGTGCCTGGG + Intronic
1148779516 17:50113447-50113469 CTGCTCTCTGCTGAGTTGCTTGG - Intronic
1149996053 17:61406427-61406449 CTCATCCCTGACATGTGGCTGGG - Intronic
1150694626 17:67394197-67394219 CTCATCTCTTCTGTGATACTGGG - Intronic
1151433323 17:74079652-74079674 CTCCCCTCTGCTCTGTGCCTTGG + Intergenic
1151579135 17:74968363-74968385 CTCAGCCCTGCTCTGTGGCCAGG - Intronic
1152350602 17:79782046-79782068 CGCCTCTCTGCTGGGTGGCAGGG + Intronic
1152408942 17:80112351-80112373 CTCATGACTCCTGTGAGGCTGGG + Intergenic
1152744959 17:82034303-82034325 CTCAGCTCTGAAGTGCGGCTGGG - Intergenic
1152912918 17:83015655-83015677 CTCACTCCTGCTGTGTGGCCTGG - Intronic
1154390810 18:13934566-13934588 CTCTTCTCTGCAGTGTGGGCAGG + Intergenic
1156352818 18:36315629-36315651 CTCATTGCTGCTGTGAGGCCAGG - Intronic
1156664524 18:39389829-39389851 ATCTGCTCTGCTCTGTGGCTGGG - Intergenic
1158446652 18:57528032-57528054 CTTATCTCTGCTCTGTGTCCGGG + Intergenic
1158525916 18:58213624-58213646 CTCATCACTGGTGAGTGACTTGG - Intronic
1160216977 18:76940839-76940861 CTCACCCCTGCTGTGCGGCCTGG - Intronic
1160461313 18:79041054-79041076 CTCCTCATTGCAGTGTGGCTTGG - Intergenic
1161017671 19:1991273-1991295 GTCATGTCTGCTGTTTGTCTTGG - Intronic
1161136037 19:2620389-2620411 CCCAGCTCTGGTGTGTGGGTTGG - Intronic
1161299423 19:3535725-3535747 CCCATGCCTGCTGGGTGGCTGGG + Intronic
1163199853 19:15759538-15759560 CTCAGCTTTGCTGTGTGGCTTGG - Intergenic
1163215125 19:15871025-15871047 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163228018 19:15978876-15978898 CTCGGTTCTGCTGTGTGACTTGG - Intergenic
1163228294 19:15980174-15980196 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163655127 19:18541591-18541613 CCCATCTGTGCTGTGAGGGTTGG - Intronic
1165821406 19:38678670-38678692 TTTCTCTCTGCTGTCTGGCTTGG + Intronic
1166144557 19:40825091-40825113 CTCCACGCTGCTGTGTGGGTGGG + Intronic
1166183185 19:41122970-41122992 CTCCACGCTGCTGTGTGGGTGGG - Intronic
1166567177 19:43772328-43772350 CTCCTCTCTGCTGTGTGACCTGG + Intronic
1167135432 19:47612767-47612789 CTAGTCTCTGCCGTCTGGCTTGG - Intronic
1167356493 19:49007280-49007302 CTCAGATCTGCTCTCTGGCTAGG + Exonic
1168239831 19:55083525-55083547 CTCGGCCCTGCTGTGTCGCTTGG - Intronic
1168720717 19:58553485-58553507 CTCAGCCCTGCTGAGTAGCTGGG + Intronic
925763632 2:7210154-7210176 GTCATATGTGCAGTGTGGCTGGG - Intergenic
926711586 2:15886465-15886487 GTCAGATCTGCTGTGGGGCTAGG + Intergenic
927248404 2:20976703-20976725 CCCTTCTCAGCTGTGTGTCTTGG + Intergenic
927884964 2:26712738-26712760 CTCATGTCTGCAGGCTGGCTCGG + Intronic
928793575 2:34989154-34989176 TTCATCTCTGGTGTCTAGCTAGG - Intergenic
929149055 2:38731621-38731643 CTTGTCCCTGCTCTGTGGCTGGG + Intronic
930800426 2:55437958-55437980 CCCATCTCGGAGGTGTGGCTGGG + Intergenic
931817031 2:65914478-65914500 CTTGTCTCTGAGGTGTGGCTTGG + Intergenic
933199757 2:79435455-79435477 CCCATTTCTGCAGTGTGGCCTGG - Intronic
933897166 2:86822060-86822082 TTCATCTCTGCCCTGTGACTGGG - Intronic
934458593 2:94196943-94196965 CTCATCACTGCTGTCTGTGTGGG + Intergenic
935083566 2:99823009-99823031 CTCTTCACTGCACTGTGGCTGGG + Intronic
936226580 2:110659546-110659568 CACTTCTCCGCTGTGTGACTGGG - Intronic
936455951 2:112674467-112674489 CTCTGCTCTGCTGTGACGCTGGG - Intergenic
938841628 2:135170595-135170617 GTCAACTCTGCTGTGTGGATCGG + Intronic
940769534 2:157825462-157825484 CTTACCTCTGCTGTGCGGCCGGG - Intronic
940828837 2:158444664-158444686 CTCAGCCCTCCTGAGTGGCTGGG - Intronic
940907180 2:159179804-159179826 AGCCTGTCTGCTGTGTGGCTTGG + Intronic
941963276 2:171274979-171275001 CTCAGCTCTGCAGTCTAGCTTGG + Intergenic
942609225 2:177725154-177725176 CTCATCTCTGGAATGTGACTCGG - Intronic
942652943 2:178187921-178187943 CTGAGCACTGCTGTGTTGCTGGG + Intergenic
945018568 2:205547522-205547544 CTCAGTTCTGGAGTGTGGCTTGG - Intronic
946728706 2:222687947-222687969 CACTTATATGCTGTGTGGCTTGG + Intronic
948185821 2:236020534-236020556 CACTTCCCAGCTGTGTGGCTTGG + Intronic
1171450629 20:25233579-25233601 TTCACCTCGGCTGTTTGGCTTGG - Intergenic
1171947415 20:31390540-31390562 CTCATCTCTGCCGTGCTGCAGGG - Intronic
1171953864 20:31444240-31444262 CTCATCTCTGCTGGGTTTCTGGG - Intronic
1172188228 20:33044825-33044847 CTCCTCTTTGCTGTGTGTCCTGG + Intergenic
1173351384 20:42248618-42248640 CTCAACACTGCTGTGTGGCCAGG - Intronic
1174450413 20:50616702-50616724 CTCTTCTCTGCTGTGTGACCGGG - Intronic
1174686863 20:52464779-52464801 CTCTTCTCAGTGGTGTGGCTGGG + Intergenic
1175977046 20:62716216-62716238 CTCTTTTCTGCTTTCTGGCTCGG + Intronic
1176246938 20:64101995-64102017 CCCACCTCTGCTGTCGGGCTTGG + Intergenic
1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG + Intergenic
1178104019 21:29298944-29298966 CTCAGCTCTGGTGAGTGGCTCGG + Intronic
1179647954 21:42786672-42786694 CTCATCTCTCCTGTGTGTGGAGG + Intergenic
1179754388 21:43486493-43486515 CTCATGTCTGCTGGGTGACTTGG - Intergenic
1180058565 21:45373339-45373361 CCCACCTTTGCTGTGTGACTTGG - Intergenic
1180642708 22:17311798-17311820 CTCTTCTCTACTGTGAGCCTGGG - Intergenic
1182079314 22:27518008-27518030 CTCCACTCTGCTGTGTGGCCTGG - Intergenic
1182281084 22:29218020-29218042 CTGCACTCTGCTGTGTGACTTGG + Intronic
1182302626 22:29346154-29346176 CTCCTCCCTGTTGTGTGGCCTGG - Intronic
1183623251 22:38986915-38986937 CACATAGCTGCTGGGTGGCTGGG + Intronic
1183745611 22:39689888-39689910 CTCATGGCCGCTGGGTGGCTGGG + Intergenic
1183850558 22:40583569-40583591 CTCAGTCCTGCTGTGTGGCCTGG - Intronic
1184039585 22:41935037-41935059 CTCAGCTCTGCTGTGAGGCAGGG + Intergenic
1184340594 22:43883888-43883910 CTCAGGTTGGCTGTGTGGCTGGG - Intronic
949810503 3:8001718-8001740 GCCATCCCTGCTGTGTGGCTTGG + Intergenic
950064942 3:10104536-10104558 CGCAACTCTGATGTGTGGCAGGG + Exonic
950463141 3:13137211-13137233 CTCATATCTGCTTTGTGTGTTGG - Intergenic
950504289 3:13384481-13384503 CTCATTTCTTCTGAGTAGCTGGG - Intronic
950659648 3:14459286-14459308 CTCAATTCCACTGTGTGGCTGGG - Intronic
951562421 3:23982022-23982044 CTCCTCTCTGCTGAGAGGATGGG - Intergenic
952707667 3:36395743-36395765 CTCTTCTCTTCTATGTTGCTTGG + Intronic
953369433 3:42374923-42374945 CTCAGCTCCCCTGAGTGGCTGGG + Intergenic
953409654 3:42683476-42683498 CCCATGTCCGCTGTGTGACTTGG + Intergenic
955691090 3:61591445-61591467 CTCCTATCTGCTGTGTCACTGGG + Intronic
956579771 3:70797197-70797219 CTCATCCCCACTGTGTTGCTGGG - Intergenic
959145887 3:102544094-102544116 ATCTTCTCTCGTGTGTGGCTTGG - Intergenic
962455761 3:135564117-135564139 CTCATCTCTCCAGTGAGACTGGG - Intergenic
962819935 3:139038702-139038724 CTTTTCTCTGCTGTCTGCCTTGG + Intronic
963541467 3:146595491-146595513 CACCTCTCTCCTGTGTAGCTGGG - Intronic
964736806 3:159926484-159926506 CTCTTCTCTACTGTGTGCCATGG - Intergenic
965106424 3:164361112-164361134 CTCACCTCTGCTGTGCCGCTTGG - Intergenic
965692790 3:171375570-171375592 CTCCTCTCTGCTGTGAAGCTGGG - Intronic
965828173 3:172751317-172751339 CACATCTGTGCCGGGTGGCTGGG - Intronic
966793554 3:183694308-183694330 CTCAGCTCTGCTCTGGAGCTTGG - Intergenic
968233068 3:197015605-197015627 CTCCTGTCAGGTGTGTGGCTGGG + Intronic
968644450 4:1732582-1732604 TTCGTGTCTGCTGTGTGCCTGGG - Intronic
969671941 4:8594472-8594494 CTCAACTCTGCTGTGTGACCTGG + Intronic
978936514 4:114383876-114383898 TTCATTCCTGCTGTGTGACTTGG - Intergenic
979295039 4:119022441-119022463 CCCACTTCTCCTGTGTGGCTAGG + Intronic
981057282 4:140375820-140375842 TTCAGCTCTGATGTATGGCTAGG - Intronic
983872290 4:172836040-172836062 GTCATCTCTGCTGCCTGGCAGGG + Intronic
984157626 4:176210993-176211015 CTCATTCCTCCTGTGTAGCTGGG + Intergenic
985585892 5:733867-733889 CTCATCTCAGCTTTGTGGGGGGG + Intronic
985629431 5:1007015-1007037 CTCGTGTCCCCTGTGTGGCTGGG - Intergenic
985816942 5:2134285-2134307 CTCAACGCTGCAGTGTGGCTGGG + Intergenic
986722114 5:10566712-10566734 TGCCTCTCTGCTGTGTGGCCTGG - Intronic
988973280 5:36490737-36490759 CTCAGCCCTGCGGAGTGGCTAGG - Intergenic
989592814 5:43127752-43127774 CCCAGCTCAGCTTTGTGGCTTGG + Intronic
990206240 5:53432673-53432695 CTTATCTCTGATGTCTGCCTTGG - Intergenic
990303013 5:54467764-54467786 CTCATGTCTCCTGAGTAGCTGGG - Intergenic
990629629 5:57653743-57653765 CTCATCTCTGTGGTTTGGCATGG + Intergenic
992457928 5:76933231-76933253 CTGTTCTCTACTGTGTTGCTGGG + Intergenic
992542416 5:77777994-77778016 CACAGCGCTGCTGTGTGACTTGG - Intronic
992628395 5:78655930-78655952 CTAATCTCAGCTGTGTGGATTGG - Intronic
994092587 5:95822209-95822231 CTGATGTCTGCTGTGCGGCAGGG - Intronic
995247454 5:109950637-109950659 CTTATCTCAGGTGTGTGGTTTGG - Intergenic
995644996 5:114301592-114301614 CTCATATCTGCACTGAGGCTCGG + Intergenic
996234535 5:121109041-121109063 CTCCTCCCTGTTGTGTGGATAGG + Intergenic
998493662 5:142568341-142568363 CTCATCTCTCCTGTCTGGGTGGG - Intergenic
998867142 5:146516709-146516731 CTCATCTCTGCAGAGTGGGTAGG - Intergenic
999393084 5:151208511-151208533 CCCAAATCTGCTGAGTGGCTGGG + Intronic
1001205998 5:169763645-169763667 CTCAGTCCTGCTGTGTGTCTGGG + Intronic
1001294393 5:170488973-170488995 CTCAGCTCTGCACTCTGGCTTGG - Intronic
1001746687 5:174098082-174098104 TCCATCCCTGCTGTGTAGCTGGG - Intronic
1002699806 5:181114792-181114814 CTCATCGCTGCCGTGGTGCTGGG + Intergenic
1003284594 6:4723705-4723727 CTCTGCCCTGCTCTGTGGCTTGG - Intronic
1004045668 6:12020467-12020489 CTCATCGCTGCTCTGTGGAGGGG + Intronic
1004514060 6:16307018-16307040 CTCATTTATAGTGTGTGGCTGGG - Intronic
1004571792 6:16853191-16853213 CTTATGTTTGCTGTGTGGCTTGG - Intergenic
1006686072 6:35835274-35835296 GTGATCTCTGCTGTGGTGCTGGG + Exonic
1006767854 6:36524658-36524680 CCCATCTGTTCAGTGTGGCTTGG - Intronic
1006882959 6:37354968-37354990 CACATTTCTCCTGTGAGGCTCGG + Intronic
1006998988 6:38290783-38290805 CACAACCCTGCTGTGTGCCTGGG + Intronic
1007780727 6:44252837-44252859 CTCAAGTCTCCTGAGTGGCTGGG + Intronic
1008731256 6:54485311-54485333 CTAATCTCTCCAATGTGGCTTGG + Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1016490102 6:144590961-144590983 CACATATCTGCTATGTGGGTTGG + Intronic
1017116316 6:150980299-150980321 CTCATTTCTCCTGTGTGGCTTGG + Intronic
1017898153 6:158699257-158699279 CTCTTCTCTCCTGGGTGACTTGG - Intronic
1018472836 6:164111861-164111883 CTCAGCTCAGCTGTGGAGCTGGG + Intergenic
1018747123 6:166771244-166771266 CTCGTCACTGATGCGTGGCTTGG - Intronic
1019331919 7:464533-464555 CTCAGCTCGGCAGCGTGGCTGGG - Intergenic
1019674230 7:2301850-2301872 CTCATCTCTGAAGTGAGGCTAGG + Intronic
1019702660 7:2481486-2481508 CCAATCTCTGCTGCCTGGCTGGG + Intergenic
1019705619 7:2495943-2495965 CTCCTCTCTGCAGTGGGGGTGGG - Intergenic
1019877366 7:3825924-3825946 CTCATTTGTGATGTGGGGCTAGG - Intronic
1019922171 7:4169871-4169893 CGCATCTGTCCTGTGTGACTCGG - Intronic
1022628793 7:32065779-32065801 CTCATCTTTGCTGTGTAGGTTGG + Intronic
1022839649 7:34150971-34150993 CCCACCTCTTCTGTGTGGATGGG - Intronic
1023371962 7:39520559-39520581 CTCATGTTTGCTGTGTGCCAAGG - Intergenic
1024636903 7:51298530-51298552 CTCACATCTGCTTTGTTGCTGGG - Intronic
1024941422 7:54767303-54767325 TTGCTCTCTGCTGTGTGGCCAGG + Intergenic
1025005376 7:55350193-55350215 TTCATTTCTGCTTTGTGCCTAGG - Intergenic
1026361980 7:69610473-69610495 CTCCTCTCTGCAGGGAGGCTGGG + Intronic
1026568470 7:71509525-71509547 ATTATCTCTGTTGTGTAGCTAGG + Intronic
1026792847 7:73346041-73346063 TTCATCTCTGCTGTGTGCCTTGG - Intronic
1027536713 7:79412505-79412527 CTTGTCTCTGCTGTGATGCTTGG - Intronic
1027900469 7:84107689-84107711 CTCATTGCTGCTGTATGGGTGGG - Intronic
1028480350 7:91297698-91297720 CTCATCTTGGCTTTGTGGTTAGG + Intergenic
1030372552 7:108716788-108716810 CTCCTCTCTGCTTTATCGCTGGG - Intergenic
1030536407 7:110772336-110772358 CTCTTCTCTGCTGTCTGGTCAGG + Intronic
1030694731 7:112572376-112572398 CTCTTCTCTGCTCTGTGCCTAGG - Intergenic
1031529755 7:122862280-122862302 CTATTCTCTGCTCTGTGCCTTGG + Intronic
1032076658 7:128839199-128839221 CTCACCTGTGCTGTGTGGCATGG + Intronic
1032374003 7:131391544-131391566 CACATTTCTACTGTGTGGCAGGG + Intronic
1033286605 7:140046846-140046868 CTTGTCTCTGCTTTGTGCCTGGG - Intronic
1035366254 7:158350765-158350787 CTCATCTGAACTGTGAGGCTGGG - Intronic
1035424987 7:158764647-158764669 GTCGTGTCTGCTGTGTTGCTGGG - Intronic
1036282702 8:7415348-7415370 CTGATCTCTCCTGAGTGACTGGG + Intronic
1036338772 8:7896201-7896223 CTGATCTCTCCTGAGTGACTGGG - Intronic
1037734874 8:21557703-21557725 CTCATCTCTGAGGCATGGCTGGG + Intergenic
1040008464 8:42640877-42640899 CTCAGATCTGCTCTGTGCCTGGG - Intergenic
1040799606 8:51325884-51325906 TTCTTCTGTGCTGTTTGGCTGGG + Intronic
1044218002 8:89635636-89635658 GGAATCTCTGCTCTGTGGCTTGG - Intergenic
1044519848 8:93186940-93186962 CTGAGCTGTGCTGTGTTGCTTGG - Intergenic
1044866388 8:96575079-96575101 CTCACCTCTGCTGTGCAGCCTGG + Intronic
1045026781 8:98094994-98095016 CTCACCTCTCCTGAGTAGCTGGG + Intergenic
1045601453 8:103722256-103722278 CTCCTCACCCCTGTGTGGCTGGG - Intronic
1046957293 8:120074687-120074709 CTCTTTTCTGCTGTGTCTCTAGG - Intronic
1047078438 8:121431952-121431974 CTAATCTTTGCTGTGTGGGCTGG - Intergenic
1047983123 8:130204081-130204103 CTCACTCCTGCTGTGTGGCCTGG - Intronic
1047997384 8:130349716-130349738 CTCAGCTCTCCTGTGAGGCAGGG - Intronic
1049685786 8:143938855-143938877 TGGGTCTCTGCTGTGTGGCTGGG - Intronic
1050092918 9:2033594-2033616 GTCATTTCTGGTGGGTGGCTGGG + Intronic
1051367034 9:16328637-16328659 CTCATCTCTTTTGGGTGGCGGGG - Intergenic
1051915419 9:22201005-22201027 CACCTCTCTGCTGAGTGGGTTGG - Intergenic
1052371437 9:27669726-27669748 CTCATCTCAGCTGGGTGCCATGG + Intergenic
1053011639 9:34637141-34637163 CTCCTTTCTGATGTTTGGCTGGG - Intronic
1053014983 9:34656822-34656844 CTCATCAGTGCTGTCTGCCTGGG - Exonic
1054449552 9:65396203-65396225 TTCATCTCTGCTGCTTGGCCTGG + Intergenic
1054723534 9:68627284-68627306 CACATATTTGCTGTGTGACTTGG + Intergenic
1054872073 9:70056716-70056738 CTCAATCCTGCTGTGTGGCTGGG - Intronic
1056873270 9:90304620-90304642 CTCATCTCTGCTGTGGTGGCTGG - Intergenic
1058135007 9:101297338-101297360 CTCCTCTCGTCTGTGTGGCATGG + Intronic
1059593894 9:115694956-115694978 CTCATCTCTGCTTTCTTCCTTGG + Intergenic
1060519138 9:124284016-124284038 GACGCCTCTGCTGTGTGGCTTGG + Intronic
1060983446 9:127806859-127806881 CTCATCTCTCCTGTGTCCCTCGG - Intronic
1061431094 9:130531814-130531836 CTGCTCTCTGGTCTGTGGCTGGG - Intergenic
1061880548 9:133566821-133566843 CTCAGCTCAGCTTTCTGGCTTGG - Intronic
1062343736 9:136105259-136105281 GTCAACTCTGCTGTGTCCCTTGG - Intergenic
1062601256 9:137319581-137319603 GTCATCACGGATGTGTGGCTTGG + Intronic
1062638046 9:137501703-137501725 CTCATCTCTGTTGGATGGCCGGG - Exonic
1187098330 X:16168976-16168998 CTCAGCTCTGCTGTGCGCCCTGG + Intronic
1187393235 X:18899268-18899290 CTCCTCTCTGCTGTGTCTCTTGG - Intronic
1187439769 X:19307483-19307505 CTCCACTCTGCTGTATGCCTGGG - Intergenic
1190199854 X:48351435-48351457 CTGGTCTCTGCTGTGTTACTGGG - Intronic
1190666632 X:52701916-52701938 CTGGTCTCTGCTGTGTTGCTGGG - Intronic
1190672786 X:52756492-52756514 CTGGTCTCTGCTGTGTTGCTGGG + Intronic
1191215615 X:57929793-57929815 CTCATTTCTCCTGTGTGATTTGG + Intergenic
1192218385 X:69179786-69179808 CTCACCTCTGCTGAGTGGCGTGG + Intergenic
1192220659 X:69195410-69195432 CTCATCTCTGCTGTCAGGCCCGG + Intergenic
1195720725 X:107865425-107865447 TTCATCTCTTATGTGTGTCTGGG + Intronic
1198079212 X:133223282-133223304 CAAATCCTTGCTGTGTGGCTTGG + Intergenic
1201962477 Y:19697035-19697057 CTCATATCAGATGTATGGCTTGG - Intergenic
1202373405 Y:24213061-24213083 CTCAAAGCTGCTGTGGGGCTCGG + Intergenic
1202497376 Y:25457059-25457081 CTCAAAGCTGCTGTGGGGCTCGG - Intergenic