ID: 1089788314

View in Genome Browser
Species Human (GRCh38)
Location 11:120923904-120923926
Sequence CATCCACCCAGCACACTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 223}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089788308_1089788314 23 Left 1089788308 11:120923858-120923880 CCCTCTGATGGCTCTCTGGCCTA 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1089788314 11:120923904-120923926 CATCCACCCAGCACACTGTCAGG 0: 1
1: 0
2: 1
3: 13
4: 223
1089788309_1089788314 22 Left 1089788309 11:120923859-120923881 CCTCTGATGGCTCTCTGGCCTAG 0: 1
1: 0
2: 2
3: 12
4: 129
Right 1089788314 11:120923904-120923926 CATCCACCCAGCACACTGTCAGG 0: 1
1: 0
2: 1
3: 13
4: 223
1089788305_1089788314 30 Left 1089788305 11:120923851-120923873 CCCAGGACCCTCTGATGGCTCTC 0: 1
1: 1
2: 2
3: 25
4: 224
Right 1089788314 11:120923904-120923926 CATCCACCCAGCACACTGTCAGG 0: 1
1: 0
2: 1
3: 13
4: 223
1089788306_1089788314 29 Left 1089788306 11:120923852-120923874 CCAGGACCCTCTGATGGCTCTCT 0: 1
1: 0
2: 3
3: 21
4: 255
Right 1089788314 11:120923904-120923926 CATCCACCCAGCACACTGTCAGG 0: 1
1: 0
2: 1
3: 13
4: 223
1089788313_1089788314 4 Left 1089788313 11:120923877-120923899 CCTAGTGTCAGATTCTGGTGGGT 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1089788314 11:120923904-120923926 CATCCACCCAGCACACTGTCAGG 0: 1
1: 0
2: 1
3: 13
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089788314 Original CRISPR CATCCACCCAGCACACTGTC AGG Intronic
900250979 1:1669560-1669582 CAACCAGCCAGCACACGGCCTGG + Intronic
900884030 1:5402887-5402909 CAGCCACCAAGGGCACTGTCTGG - Intergenic
901929559 1:12588302-12588324 CATGTACTCAGCACAGTGTCTGG - Intronic
902396454 1:16134650-16134672 CAAGCACCCAGCACACAGTAGGG - Intronic
905210354 1:36369794-36369816 CCTGCACCCAGCCCACTGCCTGG + Intronic
906186083 1:43863123-43863145 CATGGTCCCAGCTCACTGTCTGG + Intronic
906212600 1:44020468-44020490 CATTCATCTAGCACACTGCCAGG - Intronic
907048826 1:51316164-51316186 CCAGCACCCAGCACACTGCCGGG + Intronic
907946291 1:59139503-59139525 CAGCAGCCCAGCCCACTGTCTGG + Intergenic
908326803 1:63031011-63031033 CTAACACCCAGCACACTGCCTGG + Intergenic
909471973 1:76039462-76039484 ATTGCACCCAGCACAATGTCTGG + Intergenic
912132507 1:106619849-106619871 CTTCCACCCAGTAACCTGTCTGG - Intergenic
915705835 1:157842770-157842792 CCTCCACCCATCACATTGCCTGG - Intronic
916825079 1:168435256-168435278 CATCCCCCCAGCAGACTCTGTGG + Intergenic
917170340 1:172165930-172165952 CAAGCACCCAGCACAGTGCCTGG - Intronic
918306603 1:183252306-183252328 CATCCTCCCAGCACGCTCTGGGG - Exonic
918536729 1:185582992-185583014 CAACCCCTCAGCTCACTGTCTGG - Intergenic
920218616 1:204378893-204378915 CAGCAACTCAGAACACTGTCAGG + Intergenic
920859471 1:209693672-209693694 GCTCAGCCCAGCACACTGTCTGG + Intronic
921585391 1:216940523-216940545 CATGCACCAAACAAACTGTCAGG - Intronic
923247028 1:232142628-232142650 CATGTACCCAGGACACTGCCAGG + Intergenic
924870371 1:248036724-248036746 CCTCTACCCAGAAAACTGTCAGG + Intronic
1062844786 10:695786-695808 CATCCACCAAGCAGTGTGTCCGG + Intergenic
1067048282 10:42998047-42998069 CACACACCCAGCATAATGTCTGG - Intergenic
1069897719 10:71689306-71689328 CACCCACCCAGCTCATTGTCAGG - Intronic
1071515451 10:86293828-86293850 AATGCACCCAGCACAGTGCCTGG - Intronic
1074493510 10:113959360-113959382 CATACCCCCAGCACACAGGCAGG + Intergenic
1074939212 10:118218404-118218426 CAGGCACCCAGCACCATGTCTGG + Intergenic
1075331466 10:121577314-121577336 AAGGCACCCAGCACAATGTCTGG + Intronic
1075654657 10:124152995-124153017 CATCCTCCCAGCAGCCTGTGAGG + Intergenic
1077135382 11:995559-995581 CTCCCAACCAGCACACTGCCAGG - Intronic
1077594564 11:3520656-3520678 CCACCACCCAGCACAGTGCCTGG + Intergenic
1077974347 11:7232172-7232194 CAGCCACACCGCACACTGTGTGG - Intergenic
1077992954 11:7428488-7428510 CTTCCTCCCACCACACTATCAGG - Intronic
1078937601 11:15965348-15965370 CATTCTCCCAGCACCCTGACAGG + Intergenic
1080554140 11:33400785-33400807 CAGGCACCCTGCACAGTGTCTGG - Intergenic
1080695824 11:34602322-34602344 CATTCACCTGGCACAATGTCTGG - Intergenic
1084461069 11:69296926-69296948 AACACACCCAGCACAGTGTCTGG - Exonic
1086421673 11:86643758-86643780 CATGAACCCAGCACAGTGCCTGG + Intronic
1086867696 11:92000027-92000049 CATCCTCCCAGCACTCTGGGAGG - Intergenic
1089055514 11:115581599-115581621 CAGCCTCCCAGCACTCTGGCTGG + Intergenic
1089633859 11:119799950-119799972 CATGCACCAAGCACAGTGTTAGG - Intergenic
1089788314 11:120923904-120923926 CATCCACCCAGCACACTGTCAGG + Intronic
1092420738 12:8329445-8329467 CCACCACCCAGCACAGTGCCTGG + Intergenic
1092599291 12:10041101-10041123 CAGGCACCCACCACCCTGTCTGG - Intronic
1092890909 12:12968491-12968513 CACCCACCCAGCATACTCACTGG + Intergenic
1095192366 12:39272245-39272267 CATTCACCCAGAAAAATGTCTGG + Intergenic
1100623321 12:96303191-96303213 CATTTACCCAGCACAATGTTAGG + Intronic
1101118221 12:101552792-101552814 CAAGCACCTAGCACAGTGTCTGG - Intergenic
1102104948 12:110313453-110313475 CAGGCACCCACCACAATGTCCGG + Intronic
1102186198 12:110950691-110950713 CACCCAGCCAGCGCCCTGTCCGG - Intergenic
1102533321 12:113562971-113562993 CATTCCACCAGCACAGTGTCAGG + Intergenic
1103316665 12:120061783-120061805 CAACCAACCAGCACATTATCCGG + Exonic
1104109246 12:125689802-125689824 CATCCAAGCAGCACACCTTCAGG - Intergenic
1105836342 13:24215465-24215487 CTTCCACCCAGCAGCCTATCAGG - Intronic
1106547005 13:30739365-30739387 CCTGCACCCAGGACACTGCCTGG + Intronic
1109756452 13:66767206-66767228 CATCTCCCCAGCACAGTGCCGGG - Intronic
1112961175 13:105128319-105128341 CAAGCACCCAACACACTGTCTGG - Intergenic
1113595084 13:111525628-111525650 CATCCACCCATCATTCTATCTGG - Intergenic
1114058145 14:18993151-18993173 AATCCACCCAGCACTTTGTGAGG - Intronic
1114104402 14:19408603-19408625 AATCCACCCAGCACTTTGTGAGG + Intronic
1115650804 14:35401886-35401908 TATCCACACTGCACACTGCCTGG - Exonic
1117829940 14:59740187-59740209 CTTGCACCCAGCACAGTGCCTGG + Intronic
1118711817 14:68525737-68525759 CTTCCAGCCAGCACAGGGTCTGG + Intronic
1119749100 14:77064967-77064989 CATCCTCCCAGCATGCTGGCAGG + Intergenic
1121006216 14:90492133-90492155 CACCCACCCACCACTGTGTCTGG - Intergenic
1121085585 14:91143770-91143792 CAAATACCCAGCACAATGTCTGG - Intronic
1121718639 14:96094149-96094171 CCACCACCCAGCACAGTGCCTGG + Intergenic
1122863512 14:104593283-104593305 CACCCACCCAGTCCACTGCCAGG + Exonic
1122901181 14:104782942-104782964 CGCCCACCCAGCATCCTGTCTGG - Intronic
1124998452 15:34746814-34746836 CAGACACTCAGAACACTGTCCGG + Intergenic
1125221560 15:37342767-37342789 GATACACCCAGCACAATGCCTGG + Intergenic
1126776651 15:52106159-52106181 CATCAGCTCAGCACACTGTTAGG + Intergenic
1128136877 15:65270285-65270307 CACCCCCCCAGCACAGTTTCTGG - Intronic
1128349008 15:66876607-66876629 CAGCCCCCCAGCACTCTCTCGGG - Intergenic
1129361778 15:75028979-75029001 CCTCACCCCAGCACACAGTCGGG - Intronic
1129701737 15:77772208-77772230 CATCCACCCAGGTCATTCTCAGG - Intronic
1129713451 15:77833318-77833340 CGGGCACCCAGCACACTGCCAGG + Intergenic
1129920319 15:79314094-79314116 CATCCATCCAGCTCCCAGTCTGG + Intronic
1132223488 15:100123092-100123114 CATCCACCCAGCCCAGTGTGGGG - Intronic
1132995152 16:2818920-2818942 CAGTCACCCAGCAGTCTGTCCGG - Exonic
1135166318 16:20142132-20142154 CCTCCACACAGCACAGTCTCTGG - Intergenic
1137719776 16:50621305-50621327 CAGCCACCCAGAGCAGTGTCAGG - Intronic
1139779740 16:69340418-69340440 ACTCCTCCAAGCACACTGTCAGG - Intronic
1139890569 16:70251183-70251205 CCTCCGCCCAGCTCTCTGTCAGG + Exonic
1140895694 16:79322543-79322565 CCAGCACCCAGCACAATGTCTGG - Intergenic
1141106684 16:81239660-81239682 CATCCACCACGCACACTTGCAGG + Intronic
1142176625 16:88648225-88648247 CATCCCCACAGCACAGTGACAGG + Intronic
1142821575 17:2472417-2472439 CATCCAGCAAGCACACTGCTTGG + Intronic
1143609590 17:8010174-8010196 CAAGCACCCAACACAGTGTCTGG + Intronic
1143727448 17:8859172-8859194 CAGCCACCCAAAACACTGCCAGG - Intronic
1145825540 17:27874643-27874665 CCAGCACCCAGCACAGTGTCTGG - Intronic
1148345393 17:46900041-46900063 TATCCACACAGCACAGTGCCTGG + Intergenic
1149849995 17:60028528-60028550 CCTCCACCCAGCCCTCTGTGGGG - Intergenic
1149860172 17:60117996-60118018 CCTCCACCCAGCCCTCTGTGGGG + Intergenic
1150334784 17:64322650-64322672 CACCCACTCAAGACACTGTCAGG + Exonic
1153823751 18:8855904-8855926 CCTGCACCCAGCCCAGTGTCTGG - Intergenic
1154357434 18:13632650-13632672 CCTCCACTCACCACACTGTGGGG - Intronic
1154969996 18:21398360-21398382 CACCCACCCAGCACAGTGCTTGG + Intronic
1156122136 18:33858450-33858472 TATCCATCCAGCACAATGCCTGG + Intronic
1158285950 18:55883078-55883100 CATCTACCCAGAACACCGTATGG + Intergenic
1159337911 18:67093957-67093979 CAAACACCCAACACACAGTCTGG + Intergenic
1159995475 18:74960430-74960452 CCTCCACCAAGCACTCAGTCGGG - Intronic
1161014117 19:1975029-1975051 CACCCACCCAGCACACACCCAGG + Intronic
1161464354 19:4419994-4420016 CAGTCACACAGCACACTGGCAGG + Intronic
1161922404 19:7276397-7276419 CATACTCCCAGCACACTGGGAGG - Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1165029101 19:32984514-32984536 CATGCACCCACCACGATGTCTGG - Intronic
1166386085 19:42382103-42382125 CAAGCACCCAGCACAGTGCCTGG - Intergenic
925462297 2:4074021-4074043 CAACCCCCCAGGCCACTGTCTGG + Intergenic
926238869 2:11069737-11069759 CATCCACACAGCCCTCTGTGTGG + Intergenic
926359009 2:12067636-12067658 CATCAACTCAGCAGACTGGCTGG + Intergenic
927532137 2:23815995-23816017 CAACTACCCAGGACAATGTCTGG + Intronic
927889270 2:26738370-26738392 CATCCAGCCACCACAGTCTCTGG + Intergenic
932429885 2:71667877-71667899 CAGCCACCCAGCACAGGGCCGGG - Intronic
935761346 2:106323462-106323484 CATCCACTCAGCAATCTATCTGG + Intergenic
938333697 2:130469632-130469654 AATCCACCCAGCACTTTGTGAGG + Intronic
938356118 2:130651035-130651057 AATCCACCCAGCACTTTGTGAGG - Intronic
938476554 2:131620092-131620114 AATCCACCCAGCACTTTGTGAGG - Intergenic
941697875 2:168572844-168572866 CCACCACTCAGCACAATGTCTGG + Intronic
1169185795 20:3616301-3616323 CATTCAGCCAGCAGACTTTCTGG + Intronic
1169391550 20:5195286-5195308 CCACCACCCTGCACACAGTCTGG + Exonic
1169740069 20:8882575-8882597 AATTCAAACAGCACACTGTCTGG - Exonic
1170821534 20:19758847-19758869 CATCTGCCCTGCACACTGGCTGG - Intergenic
1171119653 20:22557646-22557668 CAGCCAGCCAGCACCCTGTGAGG + Intergenic
1172021856 20:31920266-31920288 CACACACCCAGCACAGTGCCTGG + Intronic
1172991688 20:39041313-39041335 CAGCCACCCAACCCTCTGTCTGG - Intergenic
1173107781 20:40154023-40154045 CAAGCACCAAGCACAGTGTCTGG - Intergenic
1173722561 20:45272348-45272370 CAAGCACCCAGCTCAGTGTCTGG + Intergenic
1176241006 20:64075833-64075855 CCTCCACCCCACACACTGTATGG + Intronic
1178432635 21:32529927-32529949 CCTCCACCCAGCATGGTGTCTGG - Intergenic
1179840167 21:44067380-44067402 CACCCACCCAGCAGGGTGTCGGG - Intronic
1180476632 22:15715767-15715789 AATCCACCCAGCACTTTGTGAGG - Intronic
1180975206 22:19844358-19844380 CAACCACCCACCACGCTGGCAGG + Intronic
1180981065 22:19878246-19878268 CATCCACCCTGCACCCTGCCTGG + Intronic
1181018793 22:20087412-20087434 CCTCCACCCAGCCCACTACCTGG - Intronic
1181316352 22:21973127-21973149 CTTCCACCCAGCACTCTGTGGGG + Intronic
1183827605 22:40400792-40400814 CAGCCCACCAGCACAATGTCAGG + Exonic
1184130560 22:42514424-42514446 CCTCCTCCCAGCACAGTGTTGGG + Intronic
1184140739 22:42576254-42576276 CCTCCTCCCAGCACAGTGTTGGG + Intergenic
1184670372 22:46009148-46009170 CTTCCAGCCTTCACACTGTCTGG + Intergenic
949850604 3:8416679-8416701 CAATCACCCAGAACACTGTATGG + Intergenic
949922122 3:9011080-9011102 CCTCCTACCAGCACACTGCCTGG - Intronic
950079633 3:10211935-10211957 CAGGCACCCACCACCCTGTCCGG - Intronic
950516668 3:13470931-13470953 CATGTACCCAGCACAGTGCCTGG - Intergenic
950555320 3:13692290-13692312 CATCCAGCCACCGCATTGTCTGG - Intergenic
950794015 3:15496050-15496072 CCTTCACCCAGCACCCTGTGTGG + Intronic
951978212 3:28538118-28538140 AAACCACTCAGCACAGTGTCGGG - Intronic
953318142 3:41947602-41947624 AATGCACCCAGCACACTGGCTGG + Intronic
953552827 3:43917690-43917712 CATCTTCCCAGCACAGTGGCAGG + Intergenic
954214012 3:49114391-49114413 CAGCCAACCAGCAAACTCTCAGG + Intronic
955778571 3:62460221-62460243 CATACACTTAGCACAGTGTCCGG + Intronic
956041595 3:65150783-65150805 CAAGCACCCAGCACAGTGTCTGG + Intergenic
957064704 3:75512008-75512030 CCACCACCCAGCACAGTGCCTGG + Intergenic
961288649 3:125827385-125827407 CCACCACCCAGCACAGTGCCTGG - Intergenic
961861747 3:129922096-129922118 CATGCACCCACCACAATGCCCGG + Intergenic
961898414 3:130188645-130188667 CCACCACCCAGCACAGTGCCTGG + Intergenic
963741437 3:149085987-149086009 CCTCCACCGAGCACAATGCCTGG + Intronic
965272703 3:166638806-166638828 CTTCCACCCAGGAACCTGTCTGG - Intergenic
966797953 3:183733732-183733754 CATCCACCCACCTCTTTGTCAGG - Intronic
966928865 3:184662907-184662929 GTTCCCCCCAGCACACCGTCGGG - Intronic
967076057 3:186003190-186003212 CATCCCCACAGCTCCCTGTCGGG - Intergenic
969283300 4:6186053-6186075 CAGCCACTCAACACAGTGTCTGG + Intronic
969458782 4:7316335-7316357 CAGACACACAGCACAGTGTCTGG - Intronic
970316337 4:14831750-14831772 CATACAGCCAGCACTCTGCCTGG - Intergenic
973660365 4:53099056-53099078 CAAACACCCAGAACAGTGTCTGG + Intronic
975712181 4:77171766-77171788 CAAGCACCCAGCACATTATCTGG + Intronic
976066637 4:81195291-81195313 CCTCCTCCCAGCATTCTGTCTGG + Intronic
976522619 4:86046843-86046865 CAACTACCTAGAACACTGTCTGG - Intronic
977377190 4:96220648-96220670 CTACCAACCAGCACAATGTCTGG - Intergenic
982679466 4:158411382-158411404 CATTCACTCAGCACAGTGTGTGG + Intronic
986146818 5:5085524-5085546 CCCCCACCCAGCACCCTGTCTGG - Intergenic
990342908 5:54842058-54842080 CAAACACCCAGAACATTGTCTGG - Intergenic
990392730 5:55343415-55343437 AATCCATTCAGCAAACTGTCGGG - Exonic
993579626 5:89643745-89643767 CAGGCACCCACCACAATGTCCGG - Intergenic
995956504 5:117783104-117783126 AATCCACCTAGCACAGTGCCAGG - Intergenic
997472991 5:134127127-134127149 GGTACCCCCAGCACACTGTCAGG + Intronic
999005064 5:147966982-147967004 CAACAAACCAGCACATTGTCTGG - Intergenic
1003259056 6:4500125-4500147 CCTGCACCCAGCACACTGCCTGG + Intergenic
1003548604 6:7082423-7082445 CATGCACTCAGCACAGTGCCTGG - Intergenic
1006276538 6:33008963-33008985 CATGCACCCAGCACAATGGGGGG + Intronic
1006341497 6:33449507-33449529 CATCCACCCTGCCTAATGTCAGG - Intronic
1007352014 6:41280885-41280907 CATCCTCTCAGCACACAGACTGG + Intronic
1007368049 6:41408294-41408316 CACCCACCCAGCAGGCTTTCAGG + Intergenic
1009491068 6:64291936-64291958 CATGCACTTAGCACAATGTCTGG - Intronic
1011204552 6:84877514-84877536 CACACACACAGCACACTGTAAGG + Intergenic
1011231039 6:85162314-85162336 CTAGCACCCAGCACACTGTTGGG + Intergenic
1011258790 6:85450610-85450632 CATCCAGCTGGCACACTGGCCGG - Intronic
1011754473 6:90484647-90484669 CCTACACCCAGCACAATGACAGG + Intergenic
1013219529 6:108065690-108065712 TAATCACTCAGCACACTGTCTGG + Intronic
1013774746 6:113666972-113666994 GATCCACCCAGCAATCTTTCAGG - Intergenic
1013810794 6:114042107-114042129 CATGCACCCAGCACTGAGTCTGG + Intergenic
1017191798 6:151662031-151662053 CATCCAGCCACCACTCTGCCAGG + Intronic
1017939608 6:159040273-159040295 CTGCCCCCCACCACACTGTCTGG + Intronic
1018445290 6:163852771-163852793 CCTCCACCCAGAACACTGAGGGG - Intergenic
1018478511 6:164167200-164167222 CATCCATGCAGCACGCTGGCTGG + Intergenic
1019569431 7:1703905-1703927 AAACCCCCCAGCACACAGTCCGG - Intronic
1019659647 7:2216985-2217007 CATTCACACTGCACACTGCCGGG + Intronic
1019825366 7:3279924-3279946 CATCCTCCACGCACACTGCCAGG - Intergenic
1021947102 7:25738699-25738721 CATCCACCCCGCTCACTTGCAGG + Intergenic
1022445691 7:30468944-30468966 CATCCACCCAGCTTGCTGTTGGG - Intronic
1022487820 7:30793995-30794017 CACCCACCCAGAACCTTGTCAGG - Intronic
1022806301 7:33825845-33825867 CTACCACCCAGCACAGTGCCTGG - Intergenic
1023024023 7:36035167-36035189 CCCCGGCCCAGCACACTGTCCGG - Intergenic
1023778888 7:43637264-43637286 CATCCACCCAGCACACTAGCTGG + Intronic
1024232924 7:47376465-47376487 CATGCGCCCAGCACACTGTTAGG + Intronic
1024302318 7:47896643-47896665 CCTCCCCCCAGCACACAGCCAGG + Intronic
1029112689 7:98221898-98221920 CGTCCACCCAGCACTGTGCCTGG + Intronic
1029687576 7:102159375-102159397 CAAGTACCCAGCACAGTGTCCGG + Intronic
1029736699 7:102469293-102469315 CATCCCCCCAGGTCACTGACAGG - Intronic
1030406584 7:109122398-109122420 CCACAACCCAACACACTGTCTGG - Intergenic
1032467388 7:132154682-132154704 CTTTGACCCACCACACTGTCTGG - Intronic
1034100525 7:148446177-148446199 CCTCCACCCAGCTCATGGTCAGG - Intergenic
1034478768 7:151303850-151303872 CATCCACACAGAGGACTGTCGGG - Intergenic
1034869608 7:154672378-154672400 AACACACCCAGCACAGTGTCTGG + Intronic
1036790161 8:11711944-11711966 GCTCCTCCCACCACACTGTCTGG - Intronic
1039225014 8:35378792-35378814 CATCCATCCTGCACCCTGTTAGG - Intronic
1042778385 8:72461500-72461522 CAGCCAACCTGCAGACTGTCAGG - Intergenic
1044488388 8:92781687-92781709 CCTGCACCCAGCACATTGCCTGG - Intergenic
1044748286 8:95392544-95392566 CCAGCACCCAGCAGACTGTCAGG + Intergenic
1045494538 8:102697414-102697436 GAAGCACCCAGCACACTGCCTGG + Intergenic
1046985181 8:120380155-120380177 CATACACCCAGCACAGTGCCTGG - Intergenic
1046989803 8:120439660-120439682 CAAGCACCCAGTACAATGTCTGG - Intronic
1047361522 8:124173555-124173577 CTGGCACCCAGCACAGTGTCTGG - Intergenic
1047528921 8:125657644-125657666 CATGCACCCAGCACTCCCTCTGG - Intergenic
1047533235 8:125696248-125696270 TAGGCACCCAGCACAGTGTCTGG + Intergenic
1055508363 9:76970732-76970754 CCTCCACCCAGCCCTCTGGCTGG + Intergenic
1056786496 9:89596104-89596126 CCTCCACCCCGCACACTGCTGGG - Intergenic
1059248886 9:112870715-112870737 GATTCTCCCAGCACAGTGTCAGG - Exonic
1059671030 9:116492722-116492744 CATGTACCTAGCACAGTGTCTGG - Intronic
1185556936 X:1028980-1029002 CCTCCACCCAGCTCACTGTGTGG - Intergenic
1185635883 X:1551418-1551440 TATGCACCTAGCACAGTGTCTGG + Intergenic
1187141991 X:16602516-16602538 CAAGCACCCAGCACAGTGGCTGG + Intronic
1188445246 X:30248112-30248134 CCTCCACTCAGCACTCTTTCTGG - Intronic
1188878721 X:35465521-35465543 GATCCACCCACCACTATGTCCGG + Intergenic
1190749314 X:53347118-53347140 GAAGCTCCCAGCACACTGTCTGG + Intergenic
1197626959 X:128813015-128813037 CCAGCACCCAGCACAGTGTCTGG + Intergenic
1198107555 X:133475963-133475985 CACCCACCCAGGGCACTGGCAGG - Intergenic