ID: 1089789322

View in Genome Browser
Species Human (GRCh38)
Location 11:120931257-120931279
Sequence CTTATTAGGAGGGCCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 49}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089789322 Original CRISPR CTTATTAGGAGGGCCCCTGC AGG Intronic
900399476 1:2467160-2467182 CTCAGTAGGAGGAGCCCTGCCGG + Intronic
900731233 1:4262144-4262166 CTCATTATGGGGGCCTCTGCAGG + Intergenic
908457607 1:64319553-64319575 CTCATTGGCAGAGCCCCTGCTGG - Intergenic
908802351 1:67893377-67893399 TTTAATAGGAGAGCCCCTGTAGG + Intergenic
910838821 1:91541939-91541961 CTTCTAAGGAGGAGCCCTGCTGG - Intergenic
922791703 1:228314547-228314569 CTTTTCAGGGGGGCCCCTCCTGG - Intronic
1063459188 10:6204424-6204446 TTTCTTAGGACGGCCCCCGCGGG + Intronic
1074715434 10:116214170-116214192 CTGAGTAGGAGGGCTCCTCCAGG - Intronic
1080741012 11:35064332-35064354 CAAATGAGCAGGGCCCCTGCTGG + Intergenic
1081543514 11:44053085-44053107 ATTTTTAGGATGGCCACTGCTGG + Intronic
1089789322 11:120931257-120931279 CTTATTAGGAGGGCCCCTGCAGG + Intronic
1101847763 12:108376214-108376236 ATTCTTAGAAGGGCCCCTGTGGG - Intergenic
1118611836 14:67547457-67547479 TTTCTTAGGAGAGCTCCTGCTGG + Intronic
1118839303 14:69499326-69499348 CTTATTAGCAGGGGCCCTGGAGG + Intronic
1139637467 16:68266420-68266442 GTAATTAGGACTGCCCCTGCCGG + Intronic
1142425787 16:90001598-90001620 TTTATTAGGAAGGCCCCTTCTGG + Intergenic
1142513259 17:410977-410999 CTTGTGAGGAGGGCCTCTGTGGG - Intronic
1145820715 17:27832433-27832455 CTTATTAGGCCTGCCTCTGCAGG + Intronic
1158455916 18:57607604-57607626 CTAATTGGGTTGGCCCCTGCTGG - Exonic
1161294601 19:3513292-3513314 CTTAGTCGGAGGCCTCCTGCTGG + Intronic
1164078424 19:21841978-21842000 CCTATTAGCAGGGCCCATGCAGG - Intronic
1164314137 19:24071862-24071884 CCTATTAGCAGGGCTCATGCAGG + Intronic
928992758 2:37252235-37252257 CTTTTTAGCAGGGCCAGTGCAGG - Exonic
933591508 2:84238111-84238133 CTTTTAAGGATGGCCCCTGGAGG - Intergenic
938195039 2:129319434-129319456 CCTCCTAGGAGGGCTCCTGCTGG + Intergenic
940997334 2:160163856-160163878 CTTATTAGGTGGCACCCTGGAGG - Intronic
948270410 2:236669515-236669537 CTTATTAAGAGGCCCCCTGGGGG - Intergenic
1168961239 20:1871455-1871477 CTTACTAGGTGGGGCCCAGCGGG - Intergenic
1170833629 20:19864642-19864664 CTTATTAGGAAGGCATCAGCAGG + Intergenic
1172450626 20:35020201-35020223 CCTATTATGAGGGCCCCTAATGG + Intronic
1174454792 20:50641553-50641575 CTTATTGGAAGGGCCACTGCAGG + Intronic
1174472004 20:50768175-50768197 CTTATTGGAAGGGCCCCTGCAGG - Intergenic
1184796697 22:46737418-46737440 CTCATCCGGAGGGCCTCTGCGGG + Intronic
952596993 3:35029595-35029617 CTCATTTGGAGGTCCCCTGATGG + Intergenic
960350761 3:116589824-116589846 TTTATTTGCAGGGCCCCAGCTGG + Intronic
966201020 3:177359689-177359711 CCTAAGAGGAAGGCCCCTGCAGG + Intergenic
967242263 3:187451582-187451604 CTTATTAGGATGGCCACTTCAGG - Intergenic
974729237 4:65839903-65839925 CTTTTAAGGAGGGCCCATACTGG - Intergenic
978725120 4:111960479-111960501 CTTATTAGGAGTGGCCATGAAGG + Intergenic
982307187 4:153944840-153944862 CTTATAAGGTGGGGCCCTGGTGG - Intergenic
987540025 5:19242977-19242999 CTTATTAAAATGGCCCCTTCAGG + Intergenic
992247253 5:74838590-74838612 TTTATTAGTAGGGCCTCTTCAGG - Intronic
994447179 5:99891251-99891273 AGTATTAGGATTGCCCCTGCAGG + Intergenic
1002403987 5:179014592-179014614 CTAATTTGCAGGGCCCCAGCTGG - Intergenic
1008665554 6:53712464-53712486 CTTCTTGGGAAGGCCCCTCCAGG - Intergenic
1008913143 6:56758276-56758298 CTTCTGAGGAGGGCCCTTGAAGG + Intronic
1014997943 6:128175825-128175847 TTTCTTTGGAGGGCCCTTGCTGG - Intronic
1016037863 6:139401752-139401774 CTTATTAACAGTGCTCCTGCCGG - Intergenic
1019360335 7:601577-601599 CATCACAGGAGGGCCCCTGCAGG + Intronic
1028647871 7:93119033-93119055 CTTACGAGGAGGGCTCCTGAGGG - Intergenic
1029844489 7:103398778-103398800 CTCCTGAGGAGGGCCACTGCAGG + Intronic
1057227283 9:93299085-93299107 CTTAGCGGGAGGGCCTCTGCTGG - Exonic
1057459187 9:95244211-95244233 TTTCTCAGGAGAGCCCCTGCTGG - Intronic
1057762773 9:97890023-97890045 CTTTTTATGAGTGTCCCTGCTGG - Intergenic
1062181844 9:135195152-135195174 GTCCTTAGCAGGGCCCCTGCAGG - Intergenic
1062436468 9:136548584-136548606 CTTCTTCAGAGGCCCCCTGCGGG + Intergenic
1186472654 X:9833502-9833524 CTAATTAGGAGGTCCGATGCAGG - Intronic