ID: 1089789323

View in Genome Browser
Species Human (GRCh38)
Location 11:120931258-120931280
Sequence TTATTAGGAGGGCCCCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089789323 Original CRISPR TTATTAGGAGGGCCCCTGCA GGG Intronic
900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG + Intronic
900731234 1:4262145-4262167 TCATTATGGGGGCCTCTGCAGGG + Intergenic
904616711 1:31753949-31753971 TTTTAGGGAGGGCCCCTGTAGGG - Intronic
906133322 1:43475683-43475705 TTCCTAGGAGAGCCCCCGCATGG + Intergenic
917123403 1:171664410-171664432 TTATCAGGAGGGCCTTTCCATGG - Intergenic
917433293 1:174993695-174993717 TGATTAGGGGGGCCCCTTTAAGG + Intronic
924114861 1:240735258-240735280 TTATTAGTCAGGCCCCTCCAGGG - Intergenic
1068028334 10:51677019-51677041 TTATTGGGAGGGCACATACAGGG - Intronic
1069985567 10:72280639-72280661 TTCTCAGCTGGGCCCCTGCATGG - Intergenic
1076171672 10:128325146-128325168 TTGTTTCCAGGGCCCCTGCAAGG - Intergenic
1077777294 11:5285597-5285619 ATGCTAGGAGGGCCTCTGCATGG + Intronic
1077848491 11:6051124-6051146 CTAAGAGGAGGGCCCCTGCAAGG - Intergenic
1084010589 11:66346409-66346431 TTATGAGGAGTGGCCCTGGATGG - Intronic
1085280855 11:75329505-75329527 TTAACAGGAGGGGCTCTGCAAGG - Intronic
1088289544 11:108222046-108222068 TTATTAGAAGGGCGCCAGGAAGG + Intronic
1088900145 11:114109606-114109628 TTAAGAGGATGGCCTCTGCAAGG - Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1104911021 12:132241036-132241058 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911047 12:132241126-132241148 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911077 12:132241216-132241238 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911107 12:132241306-132241328 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911168 12:132241486-132241508 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1107715270 13:43193567-43193589 ATATGAGGAGGGGCCCTGCCTGG + Intergenic
1115811640 14:37115426-37115448 ACATGAGGACGGCCCCTGCATGG + Intronic
1118611837 14:67547458-67547480 TTCTTAGGAGAGCTCCTGCTGGG + Intronic
1124600504 15:31129366-31129388 TCATTTGGTGGGACCCTGCAGGG + Intronic
1126482564 15:49142352-49142374 TTAATAGGAGGGGCACTCCATGG - Intronic
1127543676 15:59968683-59968705 TTATTACCAGGGCTCCTGCAAGG - Intergenic
1137337653 16:47566167-47566189 GTATTGGGATGGCCCATGCAGGG - Intronic
1139151877 16:64391557-64391579 TCATTAGTAGGGCCCTTTCAAGG + Intergenic
1139637468 16:68266421-68266443 TAATTAGGACTGCCCCTGCCGGG + Intronic
1142425788 16:90001599-90001621 TTATTAGGAAGGCCCCTTCTGGG + Intergenic
1142966238 17:3583567-3583589 TTATTAGGGGAGCGCCCGCAAGG + Intronic
1145927669 17:28659728-28659750 ATATGAGGAGGGCCTCTGCCCGG - Intronic
1161607013 19:5220737-5220759 GTATTACTAGGGCCCCTGAAAGG - Intronic
925988407 2:9234462-9234484 CTATTATCAAGGCCCCTGCAAGG - Intronic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
928992757 2:37252234-37252256 TTTTTAGCAGGGCCAGTGCAGGG - Exonic
932021710 2:68094342-68094364 TTATTAAGAGGGCCACTGACAGG - Intronic
941688666 2:168474892-168474914 TTATTAGGAAGCCCCATACAAGG - Intronic
948007376 2:234621509-234621531 TTATTAGAAGGCACCCAGCAAGG - Intergenic
948088853 2:235273867-235273889 TTATTTGGAGCATCCCTGCAGGG + Intergenic
948571672 2:238921726-238921748 GTATTAGAGGGGCCCCTGGAAGG + Intergenic
1170609874 20:17903804-17903826 AGATTAGCATGGCCCCTGCAAGG + Intergenic
1170956281 20:20982814-20982836 TTATTTGGAATGTCCCTGCAAGG - Intergenic
1171062616 20:21981167-21981189 TTAATAAGAGGGGCTCTGCAAGG - Intergenic
1175949420 20:62575303-62575325 GCATGAGGAGGGCCCCTCCAGGG + Intergenic
1177186170 21:17799901-17799923 TTGCTAGGAGGGACCTTGCAAGG - Intronic
1180038434 21:45263294-45263316 TGCGTAGGAGGGCCGCTGCAGGG - Intergenic
1180303978 22:11058301-11058323 GCATTAGCAGCGCCCCTGCACGG + Intergenic
1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG + Intronic
949929651 3:9068792-9068814 TTACTAGAAGGGCTCCTGGAAGG - Intronic
958679359 3:97306548-97306570 TCACTGGGAGGGACCCTGCAAGG - Intronic
962255165 3:133865522-133865544 TCATTAGGACGGGCCCTGCACGG + Intronic
966201021 3:177359690-177359712 CTAAGAGGAAGGCCCCTGCAGGG + Intergenic
967242262 3:187451581-187451603 TTATTAGGATGGCCACTTCAGGG - Intergenic
985649653 5:1101458-1101480 CTATTGGGAGGGCTCCTCCAAGG - Intronic
986713456 5:10504277-10504299 TTATCAGGAGGGACACTCCAAGG + Intergenic
998074955 5:139228345-139228367 TTATTAGGAGAGCCAGGGCAAGG - Intronic
999201551 5:149820360-149820382 TTATTGAGAGGGCCCCTGCTTGG + Intronic
1004547113 6:16608522-16608544 CTAGTAGGAGAGCGCCTGCAAGG + Intronic
1004620298 6:17325491-17325513 ATATTTGGAGGGCCTCTGTAAGG + Intergenic
1006912391 6:37571880-37571902 TTTTTATGAGGGCCAATGCAAGG - Intergenic
1008913144 6:56758277-56758299 TTCTGAGGAGGGCCCTTGAAGGG + Intronic
1019738466 7:2661624-2661646 GCATCAGCAGGGCCCCTGCATGG - Intronic
1022258044 7:28678844-28678866 TTATTAAGAGGGTTTCTGCAAGG - Intronic
1034590674 7:152136424-152136446 TTCATAGGAAGGCCCCTGCCCGG + Exonic
1036102466 8:5802111-5802133 TTATTAGGAAGGGGTCTGCAGGG + Intergenic
1041751110 8:61261719-61261741 TTCTTATGAGGGCCCCTTCCTGG - Intronic
1047725091 8:127677358-127677380 TTATTATTGGCGCCCCTGCAAGG + Intergenic
1049457232 8:142699930-142699952 TTACTAGTAAGGCCCCTGCCTGG - Intergenic
1057459186 9:95244210-95244232 TTCTCAGGAGAGCCCCTGCTGGG - Intronic
1062300828 9:135867871-135867893 TTGTTTGCAGGGCCCCTGCCTGG - Intronic
1186472653 X:9833501-9833523 TAATTAGGAGGTCCGATGCAGGG - Intronic
1192245894 X:69371320-69371342 TTACTAGGAAAGCCCCTGCCAGG - Intergenic
1192494465 X:71605872-71605894 TGAGTAGGAGGGCCCAAGCAAGG + Intronic
1198169664 X:134093440-134093462 TTAATAGGAGACACCCTGCAAGG - Intergenic
1201516702 Y:14825747-14825769 TTATTAGCAGGGCCCCAGGGAGG - Intronic
1202178829 Y:22121997-22122019 TTTTGTGGAGGGCCCCAGCAAGG - Intergenic
1202212532 Y:22464397-22464419 TTTTGTGGAGGGCCCCAGCAAGG + Intergenic