ID: 1089791363

View in Genome Browser
Species Human (GRCh38)
Location 11:120946970-120946992
Sequence AAGTTGGTATGGAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 460}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089791363_1089791367 -10 Left 1089791363 11:120946970-120946992 CCATTTTCCCTCCATACCAACTT 0: 1
1: 0
2: 2
3: 31
4: 460
Right 1089791367 11:120946983-120947005 ATACCAACTTGTTCCACCTTTGG 0: 1
1: 0
2: 0
3: 7
4: 119
1089791363_1089791369 1 Left 1089791363 11:120946970-120946992 CCATTTTCCCTCCATACCAACTT 0: 1
1: 0
2: 2
3: 31
4: 460
Right 1089791369 11:120946994-120947016 TTCCACCTTTGGTTAACAAATGG 0: 1
1: 0
2: 1
3: 8
4: 150
1089791363_1089791370 2 Left 1089791363 11:120946970-120946992 CCATTTTCCCTCCATACCAACTT 0: 1
1: 0
2: 2
3: 31
4: 460
Right 1089791370 11:120946995-120947017 TCCACCTTTGGTTAACAAATGGG 0: 1
1: 0
2: 1
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089791363 Original CRISPR AAGTTGGTATGGAGGGAAAA TGG (reversed) Intronic
900069869 1:762669-762691 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
900555639 1:3279050-3279072 AAGTTGACATGGAGAGAAACTGG - Intronic
901991505 1:13118167-13118189 AAGTTGGTGTAGAGGTAAGAGGG - Intergenic
902665632 1:17935753-17935775 AAGGTGGGAGGGAGGGAAGAAGG - Intergenic
902793908 1:18787926-18787948 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
903395382 1:22997986-22998008 AGGGTGGTATGGAGAGATAATGG + Intergenic
904480743 1:30791748-30791770 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
906379305 1:45322081-45322103 GAGGTGGTATGGAGAGATAATGG + Intergenic
906589241 1:47008133-47008155 AAGTTGCAATGAAGGAAAAAAGG + Intergenic
906844363 1:49175223-49175245 AAGTTGATAAGGAGGGAAATGGG + Intronic
907057736 1:51387029-51387051 AAGTTGAAATGAAGGAAAAAAGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907701037 1:56788608-56788630 AAGTGGGGAGGGAGTGAAAAGGG - Intronic
908097540 1:60754941-60754963 TATATGGTATGGAAGGAAAATGG - Intergenic
908290454 1:62661262-62661284 GAGTTGGGAAGGGGGGAAAATGG + Intronic
908611518 1:65865887-65865909 GAGTTGGGATGGAGGGAGAGAGG - Intronic
908819162 1:68065791-68065813 AAGTTGGTTTGCAGGGAACAAGG - Intergenic
908904918 1:68997106-68997128 AAGTTCATATGGAGCCAAAAAGG - Intergenic
909046771 1:70720283-70720305 CAGTTGGTCTCAAGGGAAAAGGG - Intergenic
910971825 1:92863697-92863719 AAGTTGGTATAAAGGGAAAAGGG + Intronic
911480564 1:98434826-98434848 AAGTTAGGATGGAGATAAAATGG - Intergenic
911651489 1:100394070-100394092 AAGATGCAAGGGAGGGAAAAAGG - Intronic
912752668 1:112298639-112298661 AAGGAGGTATGGAGGAAAGAAGG + Intergenic
914406972 1:147385154-147385176 AAGTTGGCTTGAAGGGAAACAGG - Intergenic
915614374 1:157025424-157025446 AATCTGGTAGAGAGGGAAAAAGG + Intronic
915646417 1:157275980-157276002 CCGTTGGTATAGAGGGAGAAAGG + Intergenic
915711514 1:157903534-157903556 AGGTTGAAATGAAGGGAAAAAGG + Intergenic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
917014432 1:170513300-170513322 AAGTAGGTAGGAAGAGAAAAAGG + Intergenic
917962508 1:180155640-180155662 AAGGTGGCAGGGAGGCAAAATGG - Intronic
918713989 1:187766034-187766056 GGGGTGGTATGGAGAGAAAATGG + Intergenic
918920930 1:190708764-190708786 AAGGAGGGAGGGAGGGAAAAAGG - Intergenic
919935674 1:202248970-202248992 GAGTTGGAATGAAGGGAAAGAGG + Intronic
920202393 1:204267601-204267623 GAGATGGGATGCAGGGAAAAGGG + Intronic
920284835 1:204871925-204871947 TTGTTGGTTGGGAGGGAAAAAGG + Intronic
920753464 1:208704397-208704419 AAGTTGAAATGAAGGAAAAAAGG + Intergenic
921758587 1:218886184-218886206 AAGTTGGGAAGGAAGGACAATGG - Intergenic
922265552 1:223980657-223980679 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
922667180 1:227480529-227480551 GAGTTGGCATAGTGGGAAAAAGG + Intergenic
922779994 1:228244446-228244468 AAGTGGGCATGGAGGTCAAAGGG + Exonic
923213696 1:231830158-231830180 GAGGTGGTATGGAGAGATAATGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923752342 1:236757469-236757491 AATGTGCTATTGAGGGAAAAGGG - Exonic
924347412 1:243085656-243085678 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
1064078180 10:12287022-12287044 TACTTGGTTTGGAGGGAAAAAGG - Intergenic
1064167048 10:12995585-12995607 AAGTGGGTAGGGAGTAAAAACGG + Intronic
1064270823 10:13864453-13864475 AAGGTGGTATGTTGAGAAAAGGG - Intronic
1064886586 10:20119677-20119699 GAGATGGTATGGAGAGATAATGG + Intronic
1064958657 10:20939148-20939170 AAGTTGAAATGAAGGAAAAAAGG + Intronic
1065784858 10:29203676-29203698 AAGGAGGGAGGGAGGGAAAAAGG + Intergenic
1065886266 10:30080259-30080281 AAGATGGGAAGGAGGGAACAGGG - Intronic
1067720305 10:48723126-48723148 AGGGTGGAAAGGAGGGAAAAGGG - Intronic
1068542178 10:58307247-58307269 AAGTTGTCATGGAGGGACACTGG + Intergenic
1068619685 10:59167705-59167727 AACTGGGTATGGAAAGAAAATGG - Intergenic
1068791663 10:61036716-61036738 AGCTTGGTATAGAGGGACAATGG + Intergenic
1070893929 10:79965467-79965489 AGGGTGGTATGGAGAGATAATGG - Intronic
1071218050 10:83430567-83430589 AAGTGGGTATTAAGGGAAAGAGG + Intergenic
1072288726 10:93942382-93942404 AAAATGGCATGGAGAGAAAAAGG + Intronic
1072471769 10:95719982-95720004 AGCTGGGTATGGAGGGACAATGG + Intronic
1073625355 10:105091106-105091128 AAGGAGGGAGGGAGGGAAAAAGG - Intronic
1074793834 10:116920746-116920768 AAGTTGGTATGGCTGGAACATGG - Intronic
1075206600 10:120454657-120454679 AAGTGGTTTTGGAGGGCAAAAGG - Intergenic
1075639477 10:124054557-124054579 AAGATGGGATGTAGGAAAAATGG + Intronic
1077077480 11:708099-708121 CTGTTGGTATGGAGGGTCAAGGG - Intronic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077468426 11:2745129-2745151 AAGTTGGCATGGAGGAATAAAGG - Intronic
1077524540 11:3056658-3056680 AGGTTGGTATTTAGGGAAATGGG - Intronic
1077671371 11:4160859-4160881 AAGTAGATCTGGAGGGACAAAGG - Intergenic
1080164192 11:29217229-29217251 AAGTAGATATGGAGATAAAAAGG - Intergenic
1080203803 11:29706182-29706204 GAGGTGGTATGGAGAGATAATGG + Intergenic
1080237083 11:30082940-30082962 AAGGAGGGAGGGAGGGAAAAAGG + Intergenic
1082176506 11:49066242-49066264 AAGCTGTAAGGGAGGGAAAAGGG - Intergenic
1082250312 11:49971609-49971631 AAGTTGGGAGGGTGGGAGAATGG + Intergenic
1082633086 11:55563359-55563381 GAGGTGGTATGGAGAGATAATGG - Intergenic
1082634407 11:55578859-55578881 AAGTTGAAATGAAGGAAAAAAGG + Intergenic
1084253718 11:67923425-67923447 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1085630750 11:78114566-78114588 AAGGTGGTAATGGGGGAAAATGG + Intronic
1085934698 11:81126981-81127003 GGGGTGGTATGGAGAGAAAATGG - Intergenic
1086202301 11:84218254-84218276 AAGGAGGGAGGGAGGGAAAAAGG + Intronic
1086689207 11:89769633-89769655 AAGCTGTAAGGGAGGGAAAAGGG + Intergenic
1086700801 11:89898575-89898597 AAGTTGGTGTGGTGGGAAGTTGG - Intergenic
1086705368 11:89945952-89945974 AAGTTGGTGTGGTGGGAAGTTGG + Intergenic
1086716651 11:90070338-90070360 AAGCTGTAAGGGAGGGAAAAGGG - Intergenic
1087446547 11:98262035-98262057 AAGTTTTTATGGAGCAAAAATGG + Intergenic
1087859842 11:103140636-103140658 AAGTTGAAATGAAGGAAAAAAGG - Intronic
1088201985 11:107347002-107347024 AAGTTGGTAGGTGGGGAAAAAGG - Intronic
1088634039 11:111802114-111802136 AAGTTGGTAAGGAGGGAAGTTGG - Intronic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1089982646 11:122785147-122785169 CAATTGGCATGGAAGGAAAAAGG + Intronic
1090697175 11:129258508-129258530 AAGTTTGGCTGTAGGGAAAATGG - Intronic
1091102211 11:132885584-132885606 AAGTTGGTATTTGGGGTAAAAGG + Intronic
1092423791 12:8356812-8356834 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1092626342 12:10333502-10333524 GGGTTGGTATGGAGAGAGAATGG + Intergenic
1094548935 12:31431401-31431423 AAGCTGGCATGCAGGGTAAATGG + Intronic
1094732140 12:33189817-33189839 AAGTTTTTATGTAAGGAAAAAGG + Intergenic
1094806614 12:34100385-34100407 AGCTGGGTATAGAGGGAAAACGG - Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096653087 12:53071749-53071771 AAGTTGGCATGACTGGAAAAAGG + Intronic
1096906710 12:54943002-54943024 GAGGTGGTATGGAGAGATAATGG + Intergenic
1097284732 12:57868755-57868777 AAGCTGAGATGGAGGGAAAGGGG - Intergenic
1097934739 12:65233722-65233744 TAGTTAGTAAGAAGGGAAAAAGG - Intronic
1098052699 12:66471131-66471153 AAGTGGCTCTGGAGGTAAAAAGG + Intronic
1098056555 12:66512212-66512234 AAATTGGTATTGAGAGAAATGGG + Intronic
1098639085 12:72818171-72818193 GAGGTGGTATGGAGAGATAATGG + Intergenic
1100277317 12:93082823-93082845 AAATTGGTCTGTGGGGAAAAAGG + Intergenic
1101975545 12:109354993-109355015 CATTTGGTATGGAGGAAAAGGGG + Intronic
1102987969 12:117294112-117294134 AACTGGGTATGTAGGGAGAATGG - Intronic
1103136682 12:118513632-118513654 AAGCTGGCAAGGAGGGAAATAGG - Intergenic
1104293574 12:127491418-127491440 AAGTCTTTATGGGGGGAAAAAGG + Intergenic
1104697742 12:130876804-130876826 AAGTTGATACGCAAGGAAAATGG + Exonic
1106223277 13:27765460-27765482 AAGTTGGAATAGTGGGAAGAAGG - Intergenic
1107590079 13:41894382-41894404 AAGTAGGGATAGATGGAAAAAGG + Intronic
1107618860 13:42203549-42203571 AATCTGATATGGAGGGAAGATGG - Intronic
1107917659 13:45168951-45168973 AAGGAGGTAAGGAGGGAAAGAGG - Intronic
1108685667 13:52816784-52816806 AAGCAGGTTTGGAGGGAAAGAGG - Intergenic
1110497750 13:76189615-76189637 AGGTAAGAATGGAGGGAAAAGGG - Intergenic
1110650052 13:77933706-77933728 GAGATGGTATGGAGAGATAATGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111458431 13:88513344-88513366 GGGTTGGTATGGAGAGAGAATGG + Intergenic
1111894864 13:94128884-94128906 AAGTAGTTATGGAGGAAGAATGG - Intronic
1111930512 13:94508468-94508490 GAGTAGGCATGGAGGGAAAGAGG + Intergenic
1112050029 13:95635935-95635957 AAGGAGGTAGGGAGGGAAAGAGG + Intronic
1112090493 13:96078232-96078254 AAGCTGGTATGGATGGGGAAGGG - Intergenic
1112187515 13:97142073-97142095 AAATTGATAGAGAGGGAAAAGGG + Intergenic
1112606427 13:100911107-100911129 AATTTGGTATGATGGCAAAATGG + Intergenic
1113206673 13:107925106-107925128 AAGTTGAAATGAAGGAAAAAAGG - Intergenic
1113391315 13:109899994-109900016 AAGGTGGGAAGGAGGAAAAAGGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114837336 14:26218640-26218662 GATTTGCTATGGAGGGCAAATGG - Intergenic
1116239982 14:42328272-42328294 AAGGTGATAAAGAGGGAAAAAGG - Intergenic
1116305438 14:43248042-43248064 AAGTAGGGAAGGAGGGAGAAAGG - Intergenic
1116702889 14:48262876-48262898 AGGATGGTATGGAGAGATAATGG + Intergenic
1116953068 14:50896295-50896317 GGGGTGGTATGGAGGGAGAATGG - Intronic
1117660589 14:58000325-58000347 AGGCTGGGATGGAGAGAAAAGGG - Intronic
1117823917 14:59680282-59680304 TAACTGGTATGGAGGGAAAGAGG - Intronic
1117987369 14:61400774-61400796 AATTTGTTATAGAGAGAAAATGG - Intronic
1118129913 14:62951422-62951444 AAATAGGCAGGGAGGGAAAATGG + Intronic
1118824233 14:69366031-69366053 AAGATGGTGTGGAGGGGTAAGGG + Intergenic
1118942169 14:70348027-70348049 TCGTTGGTATAGAGGGAGAAAGG - Intronic
1119288151 14:73473024-73473046 AACGTGGTATTGTGGGAAAATGG - Intergenic
1119759957 14:77143264-77143286 AAGCTGCTCTGAAGGGAAAAGGG - Intronic
1122067411 14:99183507-99183529 AAGTGGGTCTGGAAGGAACATGG - Intronic
1125408828 15:39383513-39383535 TAGTGGGTAAGGTGGGAAAAGGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126483095 15:49149305-49149327 AAGTTTGTTAGGAGGGAAAGTGG - Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1128362467 15:66972080-66972102 AACTGGGTATAGAGGGACAATGG + Intergenic
1129225545 15:74168451-74168473 AAGATGGAATTGAGGGTAAAGGG - Intergenic
1131448188 15:92516922-92516944 GAGATGGTATGGAGAGATAATGG - Intergenic
1131449318 15:92525987-92526009 AAGGAGGGATGGAGGGAAAAAGG - Intergenic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1137793931 16:51198876-51198898 GAGTTGTCATGGGGGGAAAAGGG + Intergenic
1138082632 16:54105428-54105450 AAGATGGAACGGAGTGAAAAGGG + Intronic
1138541935 16:57693544-57693566 AAGTGGGTATGAAGAGAAAAAGG + Intergenic
1140019064 16:71219597-71219619 GAGGTGGTATGGAGGAAAAGTGG - Intronic
1140126609 16:72123525-72123547 AAGTGAGTATGGGAGGAAAAAGG - Exonic
1140490947 16:75335384-75335406 AATTTGGTGGGAAGGGAAAAGGG - Intronic
1140583009 16:76253738-76253760 AAGTTGAAATGAAGGAAAAAAGG - Intergenic
1141756782 16:85996746-85996768 AAGGAGGGATGGAGGGAAAGAGG + Intergenic
1142938570 17:3360904-3360926 AAGTTCATATGGAGCCAAAAAGG - Intergenic
1143801370 17:9384929-9384951 TTTTTGGTATGGAGAGAAAAGGG - Intronic
1143987468 17:10927250-10927272 AAGATGGAATGAAGGGATAATGG - Intergenic
1144443952 17:15309269-15309291 AAGTTGGTAGGAAGAGAAAGTGG - Intronic
1145888783 17:28400328-28400350 AAATGGGAATGGAGGGAAATAGG + Exonic
1146803390 17:35845009-35845031 AGGTGGCTATGGAGGCAAAATGG + Exonic
1148355391 17:46972252-46972274 AAGATGGGATGGAAGGAGAAGGG - Intronic
1148561347 17:48608526-48608548 AATTTGGTTTAGTGGGAAAATGG - Intronic
1148997836 17:51727090-51727112 AAGATGGTGTGGAGGCAACAGGG - Intronic
1149320437 17:55475983-55476005 AGGGTGGTATGGAGAGATAATGG - Intergenic
1150573172 17:66405934-66405956 TGGTTGGTGTGGAGGAAAAATGG + Intronic
1150860487 17:68796053-68796075 GGGGTGGTATGGAGGGATAATGG + Intergenic
1151027845 17:70700051-70700073 CAGATGTGATGGAGGGAAAATGG - Intergenic
1151178058 17:72305300-72305322 AATTTTGGATGGGGGGAAAAAGG + Intergenic
1152458042 17:80427221-80427243 GAGTTGGAATGGAGGAAGAAAGG - Intronic
1153463266 18:5361120-5361142 AAGGTGGTATGGACTGAAGAGGG - Intergenic
1153506036 18:5799659-5799681 AAGTTGGGATGGAGGTAGAGGGG - Intergenic
1155696589 18:28693529-28693551 GGGTTGGTATGGAGAGAGAATGG + Intergenic
1155930533 18:31702861-31702883 GAGTGGATATGGAGGGGAAATGG + Intergenic
1156105242 18:33651450-33651472 AAGTTGGAAAGGAGGGAGAGAGG + Intronic
1156210293 18:34932750-34932772 AAGTTTGTAGTAAGGGAAAAAGG + Intergenic
1156302775 18:35849885-35849907 AGGGTGGTATGGAGAGATAATGG - Intergenic
1156316876 18:35977707-35977729 AAAAGGGTATGGAGGAAAAATGG - Intronic
1157336622 18:46743775-46743797 AAGTTGAAATGAAGGAAAAAAGG + Intronic
1159691055 18:71487775-71487797 AAGTAGGTCTGAATGGAAAAAGG - Intergenic
1160421471 18:78750022-78750044 AAGTGGGTATGGAATTAAAAAGG - Intergenic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161880802 19:6950591-6950613 AAGTTGGAAGGGAGGAAAAATGG + Intergenic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163880995 19:19922369-19922391 AAGTTGAAATGAAGGAAAAAAGG - Intronic
1164430818 19:28187187-28187209 GAGTTGATAGGGAGGGAAAGGGG - Intergenic
1164435521 19:28225298-28225320 AAGGAGGGATGGAGGGAGAAGGG - Intergenic
1164450284 19:28356239-28356261 AGGTTGGGGTGGAGGGGAAATGG + Intergenic
1164789895 19:30967495-30967517 AAGTTTATATGGAAAGAAAAGGG + Intergenic
1164813221 19:31174759-31174781 ACATTGGTATGGAGGGGAGAGGG + Intergenic
1165330959 19:35141046-35141068 AAATTGGGAAGGAGGGAACAGGG - Intronic
1165584804 19:36904869-36904891 AAGTTGGTAGGGAGGAAAAGTGG + Intronic
1165986372 19:39772492-39772514 AATTTTGTAAGGTGGGAAAAAGG - Intergenic
1166496413 19:43306068-43306090 AAGTTGATAAGGATGGAAAGAGG + Intergenic
1166697644 19:44862684-44862706 AAGGTGGGAGGGAGGGAAACAGG + Intronic
925606946 2:5669323-5669345 AAGAAGGAAAGGAGGGAAAAGGG + Intergenic
927134609 2:20087596-20087618 GAGGTGGTATGGAGAGATAATGG - Intergenic
927211964 2:20644615-20644637 CACTTGGTATGGAAGGGAAAGGG - Intronic
927261196 2:21092809-21092831 AAGTTGGTACTGGAGGAAAATGG + Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
928729592 2:34215888-34215910 AAATTGGTCTGGAGTGAACATGG + Intergenic
929914372 2:46121963-46121985 AAGGAGGGAAGGAGGGAAAAAGG - Intronic
929960604 2:46493417-46493439 AAGATGGGAAGGAGGGAAAAAGG - Intronic
930175204 2:48294545-48294567 AGGTTGGCATGGAGCAAAAATGG - Intergenic
930192413 2:48473680-48473702 AAGTTGCAATGGAGAGAGAATGG + Intronic
930575651 2:53143826-53143848 GCGTTGGTATAGAAGGAAAAAGG + Intergenic
931036485 2:58249926-58249948 AAGATATTATGGAAGGAAAAAGG + Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932973501 2:76574149-76574171 AGGGTGGTATGGAGAGAGAATGG + Intergenic
933329268 2:80876304-80876326 AGGGTGGTATGGAGAGAGAATGG + Intergenic
934754027 2:96812856-96812878 TAAGTGCTATGGAGGGAAAAAGG - Intergenic
935524825 2:104152801-104152823 AAGGTGGTATGAAGGAAAACAGG + Intergenic
936109098 2:109650498-109650520 AGATTGGTAAGGAGGGAAAGTGG - Intergenic
936283523 2:111163005-111163027 ATCTTGTTATGGAAGGAAAAGGG + Intronic
936340938 2:111632234-111632256 AAAATAGTATGGAGGCAAAAGGG + Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
938806639 2:134812391-134812413 ATTTTGGCATGGAGGGAAACTGG - Intergenic
938968431 2:136408551-136408573 AAGATGCTAGGGAGGAAAAAAGG - Intergenic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939978333 2:148747289-148747311 AAGGTAGTATGGAGGTAGAAAGG - Intronic
940001819 2:148974114-148974136 AAGTTGGCATAGAGGAAAAGAGG + Intronic
940695002 2:156966767-156966789 AAGTTGAAATGAAGGAAAAAAGG - Intergenic
940749231 2:157605953-157605975 AAGCTGGGAAGGAGGGAAAGAGG - Intronic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
942490478 2:176484758-176484780 AAGTTGGAATGGGGGTAACATGG + Intergenic
942592223 2:177558360-177558382 AAGTAGGAATCGAGGGAATAGGG + Intergenic
942617819 2:177812798-177812820 AAGCGGGTAAAGAGGGAAAAAGG + Intronic
943062012 2:183049181-183049203 GAGGTGGTATGGAGAGATAATGG - Intergenic
943073214 2:183166211-183166233 AAGTTGGGAGGGTGGGAGAAGGG - Intergenic
943234119 2:185295588-185295610 AAGTTCATATGGAAGAAAAAAGG + Intergenic
944010805 2:194972808-194972830 GAGTTGCTATGGAGCTAAAAAGG - Intergenic
944532092 2:200677217-200677239 AAGGAGGGAGGGAGGGAAAAAGG + Intergenic
944650761 2:201828130-201828152 AAGTTGGTTTGGAGAGAAAGAGG + Intronic
945281634 2:208040923-208040945 ATGTTGCTAGGGAGGAAAAAAGG - Intergenic
945916069 2:215705247-215705269 AAATTGTTACGGATGGAAAATGG - Intergenic
945938739 2:215927577-215927599 GGGGTGGTATGGAGGGAGAATGG - Intergenic
947266508 2:228288207-228288229 AATTAGGTTAGGAGGGAAAAAGG - Intergenic
1168741247 20:193270-193292 AGGTGGGTATGGAGCGACAATGG + Intergenic
1168839607 20:901101-901123 GAGGTGGTATGGAGAGATAATGG - Intronic
1169867383 20:10216854-10216876 AAGTTGGAATAGGGGGAAAGGGG - Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170745352 20:19093872-19093894 AAGTTGATCTGGTGGGAGAAGGG - Intergenic
1171496339 20:25558597-25558619 AAGTTGGTCAAGAAGGAAAAAGG - Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173461111 20:43244015-43244037 AATTTGTGAAGGAGGGAAAAGGG + Intergenic
1174329226 20:49804604-49804626 GAGTTGGGATGCAGGGGAAAAGG + Intergenic
1175654496 20:60757454-60757476 GAGTTAGGATGGGGGGAAAATGG - Intergenic
1175658860 20:60794990-60795012 GAATTGGTAAGGAGGGAATATGG + Intergenic
1176846164 21:13878201-13878223 AGGTTGGGGTGGAAGGAAAAGGG - Intergenic
1176949722 21:15030726-15030748 TAGGTGGTAAGGAGGGAAGAAGG + Intronic
1177129241 21:17236415-17236437 AAATTGATCTGAAGGGAAAATGG - Intergenic
1178440595 21:32595003-32595025 CAGTTGGTATGAAGAGTAAATGG + Intronic
1181977046 22:26737584-26737606 AAAGTGGGATGGAGGGAAAAGGG - Intergenic
1182096870 22:27631223-27631245 AGGGTGGTATGGAGGGGAAAGGG + Intergenic
1182975278 22:34618265-34618287 AAAATAGTATGGAGGGAAAATGG + Intergenic
1182991949 22:34776604-34776626 AAGGTGATCTGGAGGGAAATTGG + Intergenic
1183786456 22:40031682-40031704 AAGTTGGCATAGTGGGAAGAGGG + Exonic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
949807713 3:7973947-7973969 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
950190257 3:10971700-10971722 ATGTTGGGATGGAGGGACATAGG - Intergenic
950205811 3:11079699-11079721 AAGTTGGCATGGGGGCAATAGGG - Intergenic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
950728625 3:14936635-14936657 AGGCTGGACTGGAGGGAAAAAGG - Intergenic
950752826 3:15144366-15144388 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
951770905 3:26256752-26256774 AAGCTAGAATGGATGGAAAAAGG - Intergenic
951896986 3:27618906-27618928 AGGTTGGTAGGGAGGGAAGGTGG - Intergenic
952089690 3:29869594-29869616 CAGTTTGTATTGAGGGTAAATGG - Intronic
952297691 3:32075680-32075702 GAGGTGGTATGGAGAGATAATGG - Intronic
952869564 3:37886314-37886336 AAGTGGGTCGGGAGGGAAATGGG - Intronic
953825293 3:46246800-46246822 AGGGTGGTATGGAGAGAGAATGG + Intronic
954656124 3:52195293-52195315 AAGGAGGGAAGGAGGGAAAAGGG + Intergenic
955185209 3:56708668-56708690 AAGTTGGTAAAGAGAGAAAGTGG + Intergenic
955878783 3:63522015-63522037 AAGTAGATCTGGAGGGACAAAGG + Intronic
956510265 3:69985646-69985668 AAGAAGGTAGGGAGGGAGAAGGG + Intergenic
957702704 3:83738307-83738329 AATTTGGTTTGGAGGACAAATGG - Intergenic
957953275 3:87151056-87151078 AAGTTGGTATGTAGAGAAGTGGG - Intergenic
958073559 3:88646913-88646935 AAGATGGGATGGAGGGAAAGGGG + Intergenic
959658077 3:108833039-108833061 GAGTTTGCATGGAGGCAAAAAGG - Intronic
960565962 3:119131761-119131783 AGGTTGAAATGAAGGGAAAAAGG + Intronic
961050824 3:123745418-123745440 AACTTGGTATTGAAGAAAAAAGG + Intronic
961285369 3:125798083-125798105 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
961871278 3:129990085-129990107 AAATGGGTCTGGAGGGCAAATGG + Intergenic
961881463 3:130064470-130064492 GAGATGGTATGGAGAGATAATGG - Intergenic
962993652 3:140603492-140603514 AAGTTGGGATAGAGGCCAAAGGG - Intergenic
963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG + Intronic
963356854 3:144218823-144218845 AATTTGGGATTGAGGGACAATGG + Intergenic
963424720 3:145111750-145111772 GAGGTGGTATGGAGAGATAATGG + Intergenic
963456273 3:145551710-145551732 GGGTTGGTATGGAGAGATAATGG + Intergenic
963684738 3:148419549-148419571 AGGGTGGTATGGAGAGAGAATGG - Intergenic
964299736 3:155274915-155274937 GGGTTGGTATGGAGAGATAATGG + Intergenic
964482307 3:157153223-157153245 TAGTTGGTTGGAAGGGAAAATGG - Intronic
964658367 3:159093082-159093104 AAGAAGGTATGGAGGTGAAAAGG - Intronic
965941769 3:174192809-174192831 AAGTTGCTAGGGAGGGAAATTGG - Intronic
966268925 3:178081629-178081651 AAGCTGTTTTGGAGGGAGAAAGG - Intergenic
966340388 3:178919111-178919133 AAGTTTGTATGGATCCAAAAAGG + Intergenic
966386170 3:179401038-179401060 AAGTGGGGGTGGAGGAAAAAAGG - Exonic
967031727 3:185613941-185613963 ATGTTGGTATGGAGGCAGATTGG - Intronic
967635575 3:191798619-191798641 AAATTCATATGGAAGGAAAACGG + Intergenic
967646329 3:191928484-191928506 CAGGTGGTATGGAGAGATAATGG + Intergenic
967726737 3:192869307-192869329 AAGGAGGGAAGGAGGGAAAAAGG + Intronic
967887040 3:194340596-194340618 AAATTGGTATAGAGAAAAAAAGG - Exonic
968900675 4:3430255-3430277 AAGATAGTGTGGACGGAAAAGGG + Intronic
969590335 4:8118403-8118425 AAACTGGGCTGGAGGGAAAAGGG - Intronic
969741732 4:9033264-9033286 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
969801098 4:9566161-9566183 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
970572165 4:17393588-17393610 AGGTTGCTATGGAGGTATAATGG - Intergenic
971256181 4:25015675-25015697 AAATGAGGATGGAGGGAAAATGG - Intronic
972960963 4:44451079-44451101 AAATTGGTAAGCAGGGAGAATGG - Intergenic
973103384 4:46300172-46300194 AAGTTGCTTTGGAGTGAAATAGG - Intronic
974079807 4:57200290-57200312 AAGTTGGTAGGGACGGCACAAGG - Intergenic
974886845 4:67829866-67829888 ATGTTGATGTGGAGGGAAATGGG + Intronic
976322894 4:83735952-83735974 AAGAAGGGAAGGAGGGAAAAGGG - Intergenic
977042376 4:92030596-92030618 GGGTTGGTATGGAGAGAGAATGG - Intergenic
977516278 4:98024164-98024186 AAGTTGGTAAGGAGCCAAGATGG - Intronic
977782013 4:100992165-100992187 GGGGTGGTATGGAGGGATAATGG + Intergenic
977811094 4:101356896-101356918 AAATTAGTATGGATGGAAAGAGG + Intergenic
978000704 4:103554276-103554298 CAGGTGGTATGGAGAGAGAATGG + Intergenic
978085961 4:104655035-104655057 AAGGAGGTAAGGAAGGAAAAAGG + Intergenic
978742913 4:112158960-112158982 ATGTATGTATGGGGGGAAAAGGG - Intronic
978767958 4:112423733-112423755 AAGTTGGTAAGGTGGGAAGTTGG - Intronic
979255303 4:118602018-118602040 AAGGAGGAAAGGAGGGAAAAAGG - Intergenic
979374867 4:119934365-119934387 AAGTTGGTGTGGCTGTAAAAGGG + Intergenic
979383776 4:120040049-120040071 AAGTTGGTGTGGCTGTAAAAGGG - Intergenic
981109266 4:140916752-140916774 AAGTTGAAATGAAGGAAAAAGGG + Intronic
981184576 4:141785842-141785864 AAGTTGGTGTGTAAGCAAAAAGG + Intergenic
981395404 4:144241943-144241965 AATTTTATATGGAGAGAAAAAGG - Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983817008 4:172143517-172143539 AAGTTAGTATGGTGCAAAAAAGG - Intronic
984395852 4:179199154-179199176 AAATTGGGATGGAGTGAAAAAGG - Intergenic
987104663 5:14626040-14626062 AAATTGGTATGGAGTGGAAATGG + Intergenic
988617315 5:32787460-32787482 AAGTTGTTCTTGAGGGAAAAGGG - Exonic
988888311 5:35583829-35583851 ATGTTGGAATAAAGGGAAAAGGG + Intergenic
989378402 5:40789631-40789653 AAGTGGGGCTGGAGGGGAAAAGG + Intronic
989619931 5:43374238-43374260 AAGTTTATATGGAGGTAGAATGG + Intergenic
990289808 5:54338276-54338298 AAATTAGTATGGAGCCAAAAAGG + Intergenic
990653113 5:57924552-57924574 AAGTTGAAATGAAGGAAAAAAGG + Intergenic
991578680 5:68131729-68131751 AAGTTGGTTAGGACGGAAAGTGG + Intergenic
994285319 5:97957571-97957593 AAGTGGGCAGAGAGGGAAAAAGG - Intergenic
994325412 5:98440491-98440513 AGGGTGGTATGGAGAGATAATGG - Intergenic
994754789 5:103780272-103780294 AGGGAGGTATGGAAGGAAAAAGG - Intergenic
994846979 5:105002050-105002072 AAGTTCGTATGGAACCAAAAAGG - Intergenic
995054334 5:107742702-107742724 AAGTTGACTTGGAGGGAAACAGG + Intergenic
995390059 5:111630479-111630501 AAGGGGGGATGGAGAGAAAAAGG + Intergenic
996187027 5:120490083-120490105 AAGTTGAAATGAAGGAAAAAAGG - Intronic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996574572 5:124967164-124967186 AGGGTGGTATGGAGAGATAATGG + Intergenic
996635069 5:125679320-125679342 AACTTGGTGTGGAGTGGAAATGG + Intergenic
997285708 5:132676738-132676760 AAGGTGGTATGCAGAGGAAAAGG + Intronic
998209470 5:140183397-140183419 AAGTGAGAATGGAGAGAAAATGG - Intronic
999915202 5:156251361-156251383 TAGTTGCTTTAGAGGGAAAAGGG - Intronic
1001951951 5:175822536-175822558 AAGATGGCCTGAAGGGAAAAGGG + Intronic
1002922583 6:1583028-1583050 AAGTTAATATGGAGAAAAAAAGG + Intergenic
1003626895 6:7749396-7749418 AAATAGGAATGAAGGGAAAATGG - Intronic
1003877401 6:10450799-10450821 AAGTTGATTTGTAGGGAACAGGG + Intergenic
1003905736 6:10698054-10698076 AAGTTTGCAAGGAGGGAGAAAGG + Intronic
1004049418 6:12060859-12060881 AATTAAGTAGGGAGGGAAAATGG + Intronic
1004420341 6:15463966-15463988 AAGCTGGTATGTAGGTAAAGAGG + Intronic
1004812724 6:19277294-19277316 AAGTTAATATGGACGGAACAAGG + Intergenic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005821785 6:29604802-29604824 AAGGAGGGATGGAGGGAACATGG + Intronic
1006325590 6:33351331-33351353 GAGGTGGTATGGAGAGATAATGG - Intergenic
1006517254 6:34551898-34551920 TAGTTGCTATGGTGGGAAACTGG - Intronic
1006604887 6:35249063-35249085 AAGTGGGTCTGGTGGGAAACGGG + Exonic
1007599695 6:43074175-43074197 AAGTTAATAAGGAGGGAAATAGG + Intronic
1009359777 6:62796947-62796969 CAGGTGGTATGGAGAGATAATGG - Intergenic
1009591210 6:65673223-65673245 GAGGTGGTATGGAGAGATAATGG + Intronic
1010314398 6:74429358-74429380 AAGTTGGAAGTGAGGGAGAAAGG - Intergenic
1010899751 6:81411920-81411942 AGACTGGTATGTAGGGAAAATGG + Intergenic
1010930751 6:81800046-81800068 AGCCTGGTAGGGAGGGAAAAAGG - Intergenic
1012689822 6:102296799-102296821 GGGGTGGTATGGAGGGAGAATGG - Intergenic
1013105981 6:107027182-107027204 TAGTTGGTTGGGAGGGAAAGGGG + Intergenic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1013434688 6:110091310-110091332 CAATTGGAAAGGAGGGAAAAAGG - Intergenic
1013773162 6:113650028-113650050 TGGTTGGTCTGGAGGAAAAAGGG - Intergenic
1014755489 6:125298096-125298118 AAGTTAGTGTGGAGGGAGAGGGG + Intronic
1014789469 6:125655912-125655934 AAGATGGGATGGAAGGAAAAGGG + Intergenic
1014891948 6:126853929-126853951 GAGGTGGTATGGAGAGAGAATGG - Intergenic
1016110655 6:140219241-140219263 AACTAGGTATTGAGGGGAAATGG - Intergenic
1016388265 6:143549580-143549602 AAGCAGCTATGGAGGGAGAAAGG + Intronic
1016761325 6:147740707-147740729 AACTAGGTATATAGGGAAAAAGG - Intergenic
1017240438 6:152162377-152162399 ATGATGGTAGAGAGGGAAAAAGG - Intronic
1017542188 6:155414129-155414151 AAGAGGCTATGGAGGAAAAATGG + Intronic
1018098393 6:160413939-160413961 AAGTTGGAATGAAATGAAAAAGG - Intronic
1018126080 6:160684155-160684177 AAGTTGAAATGAAGGAAAAAAGG - Intergenic
1020502097 7:8936257-8936279 AATTTGGTCAGGAGGGGAAAAGG + Intergenic
1020601532 7:10280222-10280244 AGCTTGGTATAGAAGGAAAATGG - Intergenic
1021262863 7:18480496-18480518 AAGTTTGTAGGGAGGGAGAGTGG + Intronic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1021899286 7:25267285-25267307 AAGGTTGTATGTAGAGAAAAAGG + Intergenic
1023156392 7:37256577-37256599 AAGGAGGGAGGGAGGGAAAAGGG + Intronic
1023463293 7:40424704-40424726 AAATTGTTTTGGAGGCAAAATGG + Intronic
1023575509 7:41622210-41622232 AAGCAGGAATGGAGGGAGAAAGG + Intergenic
1024102405 7:46045607-46045629 AAATTGGTATAGAGTGAAAAAGG - Intergenic
1024867260 7:53918284-53918306 AGGTTCATAGGGAGGGAAAAAGG + Intergenic
1025724946 7:64047810-64047832 GTGCTGGTATTGAGGGAAAAAGG + Intronic
1026112094 7:67466432-67466454 AAGGAGGGAGGGAGGGAAAAAGG - Intergenic
1026157163 7:67836670-67836692 AATTTGGTATAGGGGGATAAAGG + Intergenic
1026298997 7:69081091-69081113 AAGTTGGTATGGAAGTGGAATGG - Intergenic
1026632398 7:72048769-72048791 AAGGAGGAAGGGAGGGAAAAAGG - Intronic
1027240782 7:76326675-76326697 AAGTTGGATTGGCAGGAAAAAGG - Intergenic
1028582959 7:92425561-92425583 GAGTTGGAATGCAGGGAAACTGG + Intergenic
1030166268 7:106558883-106558905 AAGTTTGAATGAAGGAAAAAAGG - Intergenic
1030342046 7:108392005-108392027 AAGTTGAAATGAAGGAAAAAAGG - Intronic
1030445337 7:109642216-109642238 GTGGTGGTATGGAGGGATAATGG + Intergenic
1030946810 7:115733656-115733678 AAGTTGTTATGGAAGCAGAATGG - Intergenic
1032181879 7:129686790-129686812 ATGTTGGTATGAAGTGACAAAGG + Intronic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032945882 7:136851901-136851923 GAGCTGGTATGGAGGGAGAGGGG + Intergenic
1033054768 7:138040713-138040735 AAGTTCGTATGGAAACAAAAAGG + Intronic
1033909057 7:146243892-146243914 GAGATGGTATGGAGAGATAATGG + Intronic
1034721972 7:153301677-153301699 AGCTTGGTCTGGAAGGAAAACGG + Intergenic
1036246924 8:7125861-7125883 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
1036253879 8:7188549-7188571 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1036363614 8:8098930-8098952 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
1036887341 8:12568139-12568161 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1036894935 8:12626240-12626262 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1037268391 8:17095718-17095740 AAGGAGGAAAGGAGGGAAAAAGG - Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1037697858 8:21243062-21243084 AAGGCAGTAAGGAGGGAAAAAGG - Intergenic
1039016851 8:33159115-33159137 AAGTAAGGATGGAGGAAAAAAGG - Intergenic
1039656161 8:39410423-39410445 AAGTTTTTCTGCAGGGAAAAAGG - Intergenic
1040772872 8:51000206-51000228 AAGTGGGTATGGAGAGATAAAGG - Intergenic
1040869278 8:52083622-52083644 AAGTTGGTAGGGAGGGATGATGG + Intergenic
1041503500 8:58566907-58566929 GATTTGGAATGGAGAGAAAAAGG - Intronic
1041651275 8:60305875-60305897 GAGGTGGTATGGAGAGATAATGG + Intergenic
1042528028 8:69785212-69785234 AAGTGGTTTTGGAGGCAAAAAGG + Intronic
1043556063 8:81431724-81431746 AAGTTGATATGGAACCAAAAAGG + Intergenic
1044012943 8:87017131-87017153 AAATTGGTCTGGGGGTAAAACGG + Intronic
1044045287 8:87424752-87424774 AAGTTGAAATGAAGGAAAAAAGG - Intronic
1044292600 8:90490439-90490461 AAGTTGAAATGAAGGAAAAATGG - Intergenic
1044480813 8:92685744-92685766 AAGTTGGGGTGGGGTGAAAAGGG - Intergenic
1044624528 8:94223787-94223809 GAGGGGGGATGGAGGGAAAATGG + Intergenic
1046383370 8:113478139-113478161 AAGTTCATATGGAATGAAAAAGG - Intergenic
1046425558 8:114043704-114043726 AAGTTCATATGGAAGCAAAAAGG - Intergenic
1047650697 8:126917033-126917055 AAGATGGAAGGGAGAGAAAAGGG - Intergenic
1047695026 8:127394960-127394982 AAGTTCCTATGGAGAGAACAGGG - Intergenic
1050621125 9:7453058-7453080 AAGATGGTTGAGAGGGAAAAGGG - Intergenic
1050896523 9:10890217-10890239 GAGGTGGTATGGAGAGATAATGG - Intergenic
1052953861 9:34236908-34236930 AACGTGGTTTGGAGGGAACATGG - Intronic
1053078042 9:35151670-35151692 GGAGTGGTATGGAGGGAAAATGG + Intergenic
1054963388 9:70994639-70994661 AAGATGGTCTGGAGGCAGAAAGG - Intronic
1056322024 9:85444276-85444298 AAAGAGGTATGGAGGGAAGAAGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059660485 9:116395280-116395302 AGGTTGGGAGGGAGGGAAAGAGG + Intronic
1061878834 9:133558265-133558287 AAGATGGTGTGGAGAGATAAAGG + Intronic
1185843174 X:3412334-3412356 AAGTGGGCTTGAAGGGAAAAAGG - Intergenic
1186463864 X:9769317-9769339 AAGTGGGAATGGTGGGTAAATGG - Intronic
1187288251 X:17926938-17926960 AAGAAGTTATGGAAGGAAAAAGG - Intergenic
1187665169 X:21599820-21599842 AAGTTGATTTGCAGTGAAAAAGG - Intronic
1187733176 X:22277520-22277542 AAGTTTGTATGGCTGGAACAGGG - Intergenic
1187763281 X:22610870-22610892 AAGTTGAAATGAAGGAAAAAAGG + Intergenic
1187787198 X:22905142-22905164 AAGTTGGCTTTGAGGAAAAAAGG + Intergenic
1188209960 X:27410819-27410841 AACTTGATCTGGAGGGGAAAGGG - Intergenic
1188462947 X:30449414-30449436 GAGGTGGTATGGAGAGATAATGG + Intergenic
1188786787 X:34356496-34356518 AAGTTGAGTTGGAGGGAAGAAGG - Intergenic
1188842169 X:35029727-35029749 GAGATGGTAGGGAAGGAAAAGGG + Intergenic
1189117897 X:38362125-38362147 AAGTTGGGAGTGGGGGAAAAGGG + Intronic
1189373495 X:40448347-40448369 AAGGTGGTATGGAGGAAAGATGG - Intergenic
1189882944 X:45510938-45510960 AATGTGAAATGGAGGGAAAAGGG - Intergenic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1190965976 X:55302078-55302100 AAGTTGAAATGAAGGAAAAAAGG - Intergenic
1191786873 X:64925635-64925657 AAGTAGGCATGGAGGGAGGAGGG - Intronic
1192207814 X:69107702-69107724 AAGAAGGAAGGGAGGGAAAAGGG - Intergenic
1193214664 X:78849529-78849551 GAGTTGGAATGGAGAGAAAATGG + Intergenic
1193257822 X:79370083-79370105 AAGTTGGTCTGAATGGAACATGG + Intergenic
1193822980 X:86188935-86188957 TAGATGCTGTGGAGGGAAAATGG - Intronic
1194134904 X:90129632-90129654 AAGTTGGTACTGAGGGAAGTGGG + Intergenic
1194185828 X:90773837-90773859 GGGGTGGTATGGAGAGAAAATGG + Intergenic
1194677244 X:96809166-96809188 AAGTTGCAATGGAGAGAAGACGG - Intronic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1195005568 X:100682284-100682306 AAGTTAATATGGAGTAAAAAAGG - Intronic
1195417390 X:104635274-104635296 AAGTTGAAATGAAGGAAAAAAGG - Intronic
1195703161 X:107720124-107720146 AAGCTGGAATAGGGGGAAAAAGG - Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196115131 X:111991163-111991185 CAATTGGTATAGAGGGGAAAGGG - Intronic
1196220549 X:113109227-113109249 GAGGTGGTATGGAGAGAGAATGG + Intergenic
1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG + Intergenic
1196992365 X:121344381-121344403 GGGTTGGTATGGAGAGATAATGG + Intergenic
1197500246 X:127232534-127232556 GGGTTGGTATGGAGAGATAATGG - Intergenic
1197788958 X:130231569-130231591 AAGTTGGGAGGGAGGGAGGAAGG + Intronic
1197854497 X:130900764-130900786 AAAATGCTATGGAGGGATAAAGG - Intronic
1197972990 X:132134319-132134341 AAGTTGAAATGAAGGAAAAAAGG + Intergenic
1199767863 X:150953841-150953863 AAAGTGGTATGGAGGGGGAAGGG - Intergenic
1200426860 Y:3031277-3031299 AAGTTGAAATGAAGGAAAAAAGG - Intergenic
1200480690 Y:3699723-3699745 AAGTTGGTACTGAGGGAAGTGGG + Intergenic
1201232021 Y:11874245-11874267 AAGTGGGTTTGAAGGGAAAAAGG + Intergenic
1201581772 Y:15517577-15517599 GGGATGGTATGGAGGGATAATGG - Intergenic
1202105174 Y:21356103-21356125 AAGTTGAAATGAAGGAAAAAAGG + Intergenic