ID: 1089793673

View in Genome Browser
Species Human (GRCh38)
Location 11:120963052-120963074
Sequence CTCTACTAGCAGTGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 396}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089793669_1089793673 5 Left 1089793669 11:120963024-120963046 CCTTGGCCATTTCTCTGTTGATT 0: 1
1: 0
2: 4
3: 27
4: 309
Right 1089793673 11:120963052-120963074 CTCTACTAGCAGTGGGAAGAAGG 0: 1
1: 0
2: 0
3: 26
4: 396
1089793670_1089793673 -1 Left 1089793670 11:120963030-120963052 CCATTTCTCTGTTGATTGCTATC 0: 1
1: 0
2: 4
3: 33
4: 391
Right 1089793673 11:120963052-120963074 CTCTACTAGCAGTGGGAAGAAGG 0: 1
1: 0
2: 0
3: 26
4: 396
1089793667_1089793673 24 Left 1089793667 11:120963005-120963027 CCTTTTCTGGCTTGCTTCTCCTT 0: 1
1: 1
2: 10
3: 81
4: 796
Right 1089793673 11:120963052-120963074 CTCTACTAGCAGTGGGAAGAAGG 0: 1
1: 0
2: 0
3: 26
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089793673 Original CRISPR CTCTACTAGCAGTGGGAAGA AGG Intronic
900692622 1:3990197-3990219 CTTTATTAGCAGTGTGAAAACGG + Intergenic
900968605 1:5976747-5976769 CTCTACTACCCATGGGAGGAAGG + Intronic
901282346 1:8048383-8048405 CTCCACTACCAGTGGGATGACGG + Intergenic
902723802 1:18322357-18322379 CTCCACCAGAAGAGGGAAGACGG - Intronic
903161288 1:21490990-21491012 CTCCACCAGCAGAGGGCAGAGGG - Intergenic
903250322 1:22048624-22048646 CTCTGCTTGCAGTGGGAAGCTGG + Intergenic
904706747 1:32396551-32396573 CTTTATTAGCAGTGTGAAAATGG - Intergenic
909180374 1:72416126-72416148 CTTTATTAGCAGTGTGAAAATGG + Intergenic
909235770 1:73151627-73151649 CTTTATTAGCAGTGTGAAAATGG - Intergenic
909239156 1:73190772-73190794 CTTTATCAGCAGTGGGAAAATGG - Intergenic
909704164 1:78561662-78561684 CTTTATTAGCAGTGTGAAAATGG + Intergenic
911391387 1:97248509-97248531 CTTTATTAGCAGTGTGAAAATGG + Intronic
912656846 1:111493745-111493767 CTCTACTAGCTGTGTGAATGTGG - Intronic
914955935 1:152162494-152162516 GACTACTAGAAGGGGGAAGAAGG - Intergenic
917051155 1:170925080-170925102 CTTTATTAGCAGTGTGAAAATGG + Intergenic
917090278 1:171346179-171346201 CTTTACCAGCAGTGTGAAAATGG + Intergenic
917371849 1:174301480-174301502 CTCTGCCAGCAGAGGGCAGAGGG + Intronic
917600766 1:176571353-176571375 CTTTACTAGCTGTGGGAACTTGG + Intronic
917681672 1:177374358-177374380 CTTTATTAGCAGTGTGAAAACGG - Intergenic
918231408 1:182536592-182536614 CTTTATTAGCAGTGTGAAAATGG - Intronic
918847297 1:189634153-189634175 CTTTATTAGCAGTGTGAAAACGG - Intergenic
918885251 1:190184728-190184750 TACTACTAGAAGTGGGAAGGAGG + Intronic
920312564 1:205057246-205057268 CTCTACTAGCTGTGGGACCTTGG - Intronic
921258970 1:213368720-213368742 CTTTGCTAGAAGTGGCAAGAAGG - Intergenic
921647039 1:217631162-217631184 CTCTACTGCGAGTAGGAAGAGGG - Intergenic
923636367 1:235701203-235701225 GTCTGCTCGCAGTGGGAACATGG - Intronic
1063111265 10:3039415-3039437 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1063558368 10:7102525-7102547 CTTTACTAGCAGTGTGAGAACGG - Intergenic
1064401986 10:15029162-15029184 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1065071823 10:22032611-22032633 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1066340949 10:34533266-34533288 CACTACTAGAAGAGGGAGGAAGG + Intronic
1067272464 10:44804231-44804253 CTTCACCAGCAGTGGGGAGAGGG + Intergenic
1067671682 10:48329227-48329249 CTTAACTAGCAGAGGAAAGAGGG - Intronic
1068530558 10:58181099-58181121 CTCCACTAGCAGTGAGAATGAGG - Intergenic
1068631144 10:59298810-59298832 CTCTGCAAGCACTGGGAAAATGG + Intronic
1068712190 10:60147356-60147378 CTCTCCTCTCAGTAGGAAGAAGG + Intronic
1069777182 10:70933999-70934021 CTCTAGGAGCAGGAGGAAGAAGG + Intergenic
1070633665 10:78106687-78106709 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1070703609 10:78621186-78621208 TTCTGTTACCAGTGGGAAGATGG - Intergenic
1070915476 10:80151669-80151691 CACTCCTAGCTTTGGGAAGAGGG - Exonic
1072852813 10:98914379-98914401 CTTTATTAGCAGTGTGAAAATGG + Intronic
1074223785 10:111463320-111463342 CTTTACAAGCAGTGTGAAAATGG + Intergenic
1074653923 10:115560209-115560231 CTTTATTAGCAGTGTGAATATGG - Intronic
1075550512 10:123389344-123389366 CTTTATTAGCAGTGCGAAAATGG + Intergenic
1075550988 10:123392079-123392101 CTATACTAGAAGATGGAAGAAGG - Intergenic
1076242176 10:128916828-128916850 CTCCACTGGCAGAGGGAAAAGGG + Intergenic
1076757478 10:132580014-132580036 CCCTGCCAGCAGTGGGAGGAAGG - Intronic
1078826221 11:14933137-14933159 CTTTATTAGCAGTGTGAAAATGG - Intronic
1079550452 11:21690843-21690865 CCATCCTAGCAGTGGGAAGGTGG - Intergenic
1079657687 11:23002902-23002924 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1080993906 11:37577679-37577701 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1081061773 11:38488163-38488185 CTTTACCAGCAGTGTGAAAATGG - Intergenic
1081386177 11:42476231-42476253 CTCTACCCACAGTGGGAGGAGGG - Intergenic
1081634980 11:44715054-44715076 CTTTATTAGCAGTGTGAGGATGG - Intergenic
1083139282 11:60708365-60708387 CTTTACTTGCAGTGGAAATAGGG + Intronic
1083447889 11:62722195-62722217 CTCTTCTGGTGGTGGGAAGAAGG + Exonic
1083496322 11:63057440-63057462 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1083738527 11:64695230-64695252 CTTTTCCAGCAGTGGGAGGAGGG - Intronic
1087226466 11:95606385-95606407 CTTTATTGGCAGTGTGAAGACGG - Intergenic
1087606851 11:100387306-100387328 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1089330898 11:117688318-117688340 ATCTCCAAGCAGTGGGGAGAGGG + Intronic
1089793673 11:120963052-120963074 CTCTACTAGCAGTGGGAAGAAGG + Intronic
1089905824 11:122037369-122037391 CTCTACTAGCTGAGTGACGATGG - Intergenic
1090100953 11:123796373-123796395 CTCTGCCAGAAGTGGAAAGAGGG + Intergenic
1091824108 12:3497130-3497152 CTCTGCCAGCAGGGGGAAAATGG + Intronic
1091968344 12:4764367-4764389 TTCCAGTAGCAGTGAGAAGATGG - Intronic
1092928039 12:13289942-13289964 ACCTACTAGGAATGGGAAGAAGG + Intergenic
1093103566 12:15057457-15057479 CTCTAGGGGCATTGGGAAGATGG - Intergenic
1093887717 12:24481705-24481727 CTCTGCTAGCTGTGGGAACCTGG - Intergenic
1093974097 12:25401860-25401882 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1096449629 12:51727506-51727528 ATCACCTGGCAGTGGGAAGAGGG - Intronic
1097504663 12:60450613-60450635 CTCAACTAGCAGAAGGAAAAAGG - Intergenic
1097641887 12:62192080-62192102 ATCTGCGAGCAGTGGGAACAGGG - Exonic
1098531488 12:71546689-71546711 CTCTAATAGCAGTGTGTAGGAGG - Intronic
1098856823 12:75662466-75662488 CTGTATTAGCAGTGTGAAAATGG - Intergenic
1099291143 12:80777634-80777656 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1099295284 12:80822037-80822059 CTTTATTAGCAGTGTGAAAACGG - Intronic
1099503539 12:83445435-83445457 CTCTATCAGCAGTGTGAAAATGG + Intergenic
1099618911 12:84976007-84976029 CTTCACTGGCAGAGGGAAGAGGG - Intergenic
1101083656 12:101213882-101213904 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1102288266 12:111677375-111677397 TTCTAGTAGGAGTGGGATGAAGG - Intronic
1102780746 12:115562424-115562446 CACAAATAGCAGAGGGAAGAGGG - Intergenic
1103881279 12:124167735-124167757 CTCTATCAGCAGTGTGAAAACGG - Intronic
1104128915 12:125873900-125873922 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1105306259 13:19171162-19171184 CTCTACCAGCCATGGGAAGATGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106734662 13:32577157-32577179 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1107209768 13:37838142-37838164 CTTTACCAGCAGTGTGAAAATGG + Intronic
1107900756 13:45011359-45011381 CTTTATTAGCAGTGTGAAAATGG - Intronic
1108190865 13:47937443-47937465 CTTTATTAGCAGTGTGAAAATGG + Intronic
1108473802 13:50793027-50793049 AACTACTAGAAATGGGAAGAAGG - Intronic
1108504757 13:51102715-51102737 CTTTAATAGCAGTGTGAACATGG - Intergenic
1109406190 13:61903334-61903356 CTCCACTGGCAGAGGGCAGAGGG - Intergenic
1109713238 13:66185590-66185612 CTCTACTAAAACGGGGAAGAGGG + Intergenic
1109835562 13:67852073-67852095 CTATAGTAGTAGTGGGAAGTGGG + Intergenic
1110038573 13:70719239-70719261 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1110520048 13:76464907-76464929 CTTTACTAGCAGTGTGAAAATGG + Intergenic
1111015433 13:82373849-82373871 CTCTATCAGCAGTGTGAAAATGG + Intergenic
1111157859 13:84352308-84352330 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1111594274 13:90390514-90390536 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1111615200 13:90653386-90653408 CTTTATTAGCAGTGTGAAAAAGG + Intergenic
1112033840 13:95479949-95479971 CTTTATTAGCAGTGTGAAGATGG - Intronic
1113048843 13:106186105-106186127 CTTTATTAGCAGTGTGAACATGG + Intergenic
1114217467 14:20667591-20667613 TTCCACTAGCAGTGAGAAGTGGG + Intergenic
1114687409 14:24547360-24547382 CTTTATTAGCAATGTGAAGATGG - Intergenic
1114899324 14:27036994-27037016 CTCTAGTTGCAGTGGCAAGTGGG + Intergenic
1114985949 14:28229703-28229725 CTTTACTAACAGTGTGAAAATGG - Intergenic
1115747937 14:36458045-36458067 GTTTACAAGCAGTGGGGAGAAGG + Intergenic
1115883210 14:37944139-37944161 CTTTATTAGCAGTGTGAAAATGG - Intronic
1115990243 14:39143153-39143175 CTTTACTAGCAGTGTGAGAACGG - Intergenic
1117291341 14:54336572-54336594 CTCTACTAGCAGCATGAAAATGG + Intergenic
1117701394 14:58417244-58417266 CTTTACCAGCAGTGTGAAAATGG + Intronic
1118401419 14:65383169-65383191 CTCTACTAGCATGTGAAAGATGG - Intergenic
1118432007 14:65728256-65728278 CTTTATTAGCAGTGTGAAAATGG - Intronic
1119705878 14:76782242-76782264 CTCTTCTAGCAGGGCCAAGATGG + Exonic
1119862237 14:77944520-77944542 TTCTACTACCACTGGGAAGGTGG + Intergenic
1120152603 14:81054349-81054371 CTTTATTAGCAGTGTGAAAATGG + Intronic
1120312697 14:82851072-82851094 CTTTATTAGCAGTGTGAATATGG + Intergenic
1120765723 14:88325072-88325094 CTCTACTAGGACTGGGAGGATGG + Intronic
1121025677 14:90614499-90614521 GTCTAGTAGCAGTGACAAGAGGG + Intronic
1122380054 14:101296557-101296579 CTTTACCAGCAGTGTGAAAAAGG - Intergenic
1125341706 15:38682168-38682190 CTTTATTAGCAGTGTGAAAACGG - Intergenic
1126841827 15:52724788-52724810 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1126942559 15:53782105-53782127 CTTTACTAGCAGTGTGAGAATGG - Intergenic
1127409350 15:58690306-58690328 CTCTCCTAAGATTGGGAAGAAGG + Intronic
1127540222 15:59930084-59930106 CTATCCTTACAGTGGGAAGAGGG + Intergenic
1128177202 15:65566336-65566358 CTTTATCAGCAGTGGGAAAACGG - Intronic
1128775548 15:70317401-70317423 CTCTACTACCTGTGTGAAGTTGG - Intergenic
1129568141 15:76646847-76646869 TTCTCCAAGCAGTGGGATGAGGG - Intronic
1130203678 15:81855961-81855983 CTTTACTAACAGTGTGAAAACGG - Intergenic
1130338613 15:82979482-82979504 CTCTACTAGCAGAGTGGAGAAGG + Intronic
1133482409 16:6183920-6183942 CTTTACCAGCAGTGTGAAAATGG - Intronic
1134731644 16:16467312-16467334 CACTACTAGTATTGGAAAGATGG - Intergenic
1134935808 16:18244691-18244713 CACTACTAGTATTGGAAAGATGG + Intergenic
1135946064 16:26865997-26866019 ATCTCCTAGAGGTGGGAAGAAGG + Intergenic
1138439501 16:57025664-57025686 CTCTGCCAGAAGTGGGCAGAGGG + Exonic
1139312602 16:66040139-66040161 CACCACTTGCAGTAGGAAGAGGG - Intergenic
1145274781 17:21422936-21422958 CACTCCTAGGAGTGTGAAGAGGG + Intergenic
1145312632 17:21708835-21708857 CACTCCTAGGAGTGTGAAGAGGG + Intergenic
1146115151 17:30130038-30130060 TTCTATTAGAAGTGGGGAGATGG + Intronic
1146697247 17:34919101-34919123 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1146931347 17:36780333-36780355 CTCTGCCAGCAGTGTGAAGCTGG - Intergenic
1147364117 17:39949295-39949317 ATCTTCGACCAGTGGGAAGAAGG - Intergenic
1147893121 17:43731504-43731526 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1150191478 17:63245025-63245047 CTTTATTAGCAGTGTGAAAATGG + Intronic
1150949469 17:69785931-69785953 CTTTACTAGCAGTGTGAAAACGG + Intergenic
1151037397 17:70817295-70817317 CTTTACTAGCAGTGTGAAAAAGG + Intergenic
1151076246 17:71276337-71276359 TTTTAGTAGCAGTAGGAAGAAGG - Intergenic
1151608096 17:75153349-75153371 CCCAAAAAGCAGTGGGAAGAAGG + Intronic
1152301474 17:79497523-79497545 TTCTACCAGCAGTGGCAGGAAGG + Intronic
1152968622 18:140242-140264 CTTTACTAGCAGCGTGAAAAGGG - Intergenic
1153199522 18:2634298-2634320 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1153455117 18:5272118-5272140 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1153780327 18:8489908-8489930 CTCTTCTCGCAGTTGCAAGATGG + Intergenic
1155565957 18:27134516-27134538 TGCTACTAGCAGTGGCAAGTTGG - Intronic
1155810508 18:30227233-30227255 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1156618593 18:38820826-38820848 GTCTATCAGCAGTGGGAAAAGGG - Intergenic
1156694142 18:39746782-39746804 CTTGACTAGGAGTGGGAATATGG - Intergenic
1156741765 18:40339419-40339441 CTTTATTAGCAGTGTGAAAACGG - Intergenic
1156965462 18:43086037-43086059 CTTTATCAGCAGTGTGAAGATGG + Intronic
1157173961 18:45433863-45433885 CTCTCCTGGAAGGGGGAAGATGG + Intronic
1157182256 18:45508231-45508253 CTCTATTAGTATTTGGAAGAGGG + Intronic
1157987712 18:52458441-52458463 ACCTAATAGCTGTGGGAAGAAGG - Intronic
1158772912 18:60543229-60543251 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1159461177 18:68723909-68723931 CTCTACTAGGGGAGGGCAGAAGG - Intronic
1159780543 18:72655936-72655958 CTTTACCAGCAGTGTGAAAAGGG + Intergenic
1160382772 18:78473358-78473380 CTCTATCAGCAGTGTGAAAATGG + Intergenic
1161498614 19:4600784-4600806 CACTACAAGCAGAGGGGAGAAGG + Intergenic
1166233710 19:41441178-41441200 TTCTATTCACAGTGGGAAGAAGG + Intergenic
925494955 2:4436379-4436401 TTCTTTTAGCAGTGGGAAAATGG - Intergenic
925499917 2:4491037-4491059 CTTTATTAGCAGTGTGAAAACGG + Intergenic
925590225 2:5501909-5501931 CTTTATTAGCAGTGTGAAAATGG + Intergenic
925817142 2:7764567-7764589 CTTTATCAGCAGTGTGAAGATGG - Intergenic
926515350 2:13838008-13838030 CTTTATTAGCAGTGTGAAAACGG + Intergenic
928485756 2:31729360-31729382 CTTTATTAGCAGTGTGAAAATGG - Intergenic
929134382 2:38609190-38609212 CTTTATTAGCAGTGTGAAAATGG - Intergenic
930310804 2:49736974-49736996 CTTTATTAGCAGTGTGAGGATGG + Intergenic
930317948 2:49820432-49820454 CTTTATCAGCAGTGTGAAGATGG - Intergenic
932672585 2:73751365-73751387 CTCTGCTTGCATTGTGAAGAGGG + Intergenic
933401086 2:81796634-81796656 CTCTATCAGCAGTGTGAAAATGG + Intergenic
936457822 2:112688793-112688815 CTCCTCTGGCAGTGGGGAGAGGG - Intergenic
936628052 2:114169948-114169970 CACTACTAGCCGTGGGCAAATGG - Intergenic
936723442 2:115282471-115282493 CTCTACTGGAAGTGAGATGAAGG - Intronic
937008813 2:118543268-118543290 CTTTATTAGCAGTGTGAAAATGG + Intergenic
938235517 2:129703192-129703214 CTGTATTAGCAGTGTGAAAATGG - Intergenic
938241600 2:129746636-129746658 CTCTATCAGCAGTGTGAAAATGG - Intergenic
938295191 2:130173624-130173646 TTCTACCAGCCATGGGAAGATGG + Exonic
938461435 2:131500214-131500236 CTCTACCAGCCATGGGAAGATGG - Intergenic
939506574 2:143053785-143053807 CTTTATCAGCAGTGGGAAAACGG + Exonic
940070352 2:149679549-149679571 CTCCACTAGCAGTTGGTTGAGGG - Intergenic
940485091 2:154288007-154288029 CTTTACTAGCAGTGTGAGAACGG - Intronic
942601512 2:177645039-177645061 CTTTATTAGCAGTGTGAAAACGG + Intronic
944320612 2:198337257-198337279 CTCTAATAGCAATGGGGGGAAGG + Intronic
945052678 2:205839747-205839769 CTCTATCAGCAGTGTGAAAATGG - Intergenic
945337968 2:208615450-208615472 CTTTATTAGCAGTGTGAAAATGG + Intronic
945843215 2:214913375-214913397 CTTTATCAGCAGTGGGAAAATGG - Intergenic
946895700 2:224320997-224321019 CTAACCTAGCAGTGGGAAAAAGG + Intergenic
948056213 2:235010890-235010912 CTCTCCTAGGAGAGGGAGGAAGG - Intronic
948056229 2:235010959-235010981 TTCTCCTAGAAGAGGGAAGAAGG - Intronic
1172061034 20:32187709-32187731 CTCTGCAAGCAGGGGGAGGAGGG + Intergenic
1174048161 20:47748366-47748388 CTCCCCTAGCAGTGGGAAGTGGG - Intronic
1175474762 20:59263979-59264001 CTTTCCTAGAAGTGGAAAGAAGG + Intergenic
1176388305 21:6150676-6150698 CTCTGCTGGAAGTGGGAAGCTGG + Intergenic
1176777434 21:13151093-13151115 CTTTACTGGCAGTGTGAAAATGG - Intergenic
1177484909 21:21745125-21745147 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1177497373 21:21907400-21907422 CTCTAATAGCTGTGGGATGTGGG + Intergenic
1178204558 21:30448313-30448335 ATCTACCAGCAGTGGTAAAATGG - Intergenic
1178468858 21:32874132-32874154 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1179735167 21:43387572-43387594 CTCTGCTGGAAGTGGGAAGCTGG - Intergenic
1179936846 21:44611525-44611547 CTCTATCAGCAGTGTGAAAATGG + Intronic
1181794117 22:25291404-25291426 CTTTACCAGCAGTGTGAAAATGG + Intergenic
1181834114 22:25587954-25587976 CTTTACCAGCAGTGTGAAAATGG + Intronic
1182281627 22:29220725-29220747 CTGTCCTTGCAGTGGGACGAGGG - Intronic
1182645724 22:31807816-31807838 CTCTACTAGGAAAGGGCAGAGGG - Intronic
1183259209 22:36783417-36783439 TTCTATTTGCAGAGGGAAGAAGG - Intergenic
1184537561 22:45097687-45097709 CTTTACTAGCAGTGTGAAAACGG + Intergenic
1184578768 22:45397983-45398005 CTCTGCCAGCAGAGGGCAGAGGG - Intronic
1184598811 22:45530436-45530458 CACTGGTAGCAGTGGGAGGAAGG - Intronic
949369268 3:3317377-3317399 CTTTGCCAGCAGTGGGAAAATGG - Intergenic
949662017 3:6290891-6290913 CTTTATTAGCAGTGTGAAAATGG - Intergenic
949966420 3:9360517-9360539 CTCTATCAGCAGTGTGAAAATGG - Intronic
949994814 3:9608304-9608326 CTTTACCAGCAGTGTGAAAACGG - Intergenic
950225826 3:11233788-11233810 CTCTACTAGCAGAGGCCAGATGG - Intronic
950407923 3:12816154-12816176 CACTACCAGCAGTGAGAACAAGG + Intronic
950608942 3:14112434-14112456 ATCTACTAGCAGAGGCCAGATGG - Exonic
951385994 3:22043618-22043640 CTCTTCTAGCAGAGGAGAGAGGG + Intronic
951877480 3:27442923-27442945 ATCTACAAGCACTGGGAGGATGG - Intronic
951936286 3:28026073-28026095 CTTTATTAGCAGTGTGAAAATGG + Intergenic
952195611 3:31072690-31072712 CTTTATTAGCAGTGTGAAAATGG + Intergenic
953777016 3:45828119-45828141 CTCTGCAGGCTGTGGGAAGAAGG + Intronic
955217323 3:56995129-56995151 CTTTAATAGCAGTGTGAAAATGG + Intronic
956025269 3:64976779-64976801 CTCTTCTAACAGTGGAAGGAAGG - Intergenic
956220899 3:66902057-66902079 CTTTATTAGCAGGGGGAAAATGG + Intergenic
956558913 3:70551956-70551978 CTTTATTAGCAGTGTGAAAATGG - Intergenic
957292141 3:78291899-78291921 CTTTACTAGCAGCGTGAAAATGG - Intergenic
957588139 3:82158900-82158922 CTTTACTGGCAGTGTGAAAATGG + Intergenic
958993217 3:100871756-100871778 CTTTACCAGCAGTGTGAAAATGG + Intronic
959385525 3:105701028-105701050 CTCCATCAGCAGAGGGAAGATGG + Intronic
960359686 3:116696886-116696908 CTAAACTAGCAGGGAGAAGATGG - Intronic
961450781 3:127001421-127001443 CTCTGCTACCAGGGGCAAGAGGG + Intronic
962315843 3:134359091-134359113 CTCTCCTGCCAGTGTGAAGAGGG - Intronic
963357218 3:144223972-144223994 CTCTATCAGCAGTGTGAAAACGG + Intergenic
964317503 3:155459713-155459735 CTCTAATAGCAATGGGGATATGG + Intronic
965838707 3:172879691-172879713 CTTTACCAGCAGTGAGAAAATGG + Intergenic
965932004 3:174055677-174055699 CTCCACTAGCTGTTTGAAGATGG - Intronic
966285289 3:178288126-178288148 CTTTATTAGCAGTGTGAAAATGG - Intergenic
967208088 3:187142222-187142244 CTCTATTAGCAGTGTAAAAATGG - Intronic
967412350 3:189179894-189179916 CTTTACCAGCAGTGTGAAAAAGG - Intronic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
968114709 3:196081018-196081040 CTCTACAAGCAGTAAGCAGAGGG + Intronic
968392124 4:202325-202347 CTTTACTAGCAGTGTAAAAATGG + Intergenic
969723149 4:8904379-8904401 CGCAACAAGGAGTGGGAAGATGG + Intergenic
969996489 4:11317832-11317854 CTTTACCAGCAGTGTGAAAACGG + Intergenic
970172167 4:13301070-13301092 CTTTACTAGCAGTGTGAGAATGG - Intergenic
971111776 4:23592939-23592961 CTTTATTAGCAGTGGGAGAATGG + Intergenic
971278561 4:25221669-25221691 CTTTATTAGCAGTGGGAGAATGG - Intronic
971593850 4:28502273-28502295 CTTTATTAGCAGTGTGAAAATGG - Intergenic
971705610 4:30038742-30038764 CTTTATTAGCAGTGTGAAAATGG - Intergenic
972002527 4:34057513-34057535 CTTTACCAGCAGTGTGAAAATGG - Intergenic
972014649 4:34227534-34227556 CTTTACTGGCAGTGTGAAAATGG + Intergenic
972855836 4:43105519-43105541 CTTTATCAGCAGTGGGAAAACGG + Intergenic
973063635 4:45761608-45761630 CTCCACTGGCAGTGGGCACAAGG + Intergenic
973866983 4:55124620-55124642 CTCTCCTTGCAGAGCGAAGAAGG - Intronic
975543480 4:75537621-75537643 CTCTATCAGCAGTGTGAAAATGG + Intronic
977053843 4:92164174-92164196 CTTTATCAGCAGTGTGAAGATGG - Intergenic
978269368 4:106870610-106870632 CTCTCCTTGCTGTGGGAAGGTGG - Intergenic
979177032 4:117678411-117678433 CTTTATTAGCAGTGGGAAAATGG + Intergenic
979426212 4:120571183-120571205 CTTTATTAGCAGTGTGAAAATGG - Intergenic
979754296 4:124321554-124321576 CTCCATAGGCAGTGGGAAGAAGG - Intergenic
980731795 4:136833385-136833407 CTTTAACAGCAGTGTGAAGACGG + Intergenic
981795541 4:148590616-148590638 CTCTATTAGCAGTGTGAAAATGG + Intergenic
981927483 4:150155753-150155775 CCCTAGGAGCAATGGGAAGAGGG + Intronic
982279298 4:153667121-153667143 CTTTATTAGCAGTGTGAAAATGG + Intergenic
982392754 4:154883891-154883913 CTTTATTAGCAGTGTGAAAATGG - Intergenic
982428836 4:155298541-155298563 CTCTACTAGAACAGTGAAGATGG - Intergenic
982683084 4:158456212-158456234 CTCTACTTGAAGGGGGAAGGTGG + Intronic
983170003 4:164524900-164524922 CCTTAATAGCAATGGGAAGAGGG - Intergenic
984010348 4:174363811-174363833 CTTTATTAGCAGTGTGAAAATGG - Intergenic
985852785 5:2400957-2400979 CTTTACTGGCAGTGTGAAAATGG + Intergenic
985943366 5:3156677-3156699 GTCTACTAGCAGTGTGAGAATGG - Intergenic
987467147 5:18285515-18285537 CTCTTCTAACAGTGAGAAAATGG - Intergenic
988593048 5:32565759-32565781 CTCTACAAGGGTTGGGAAGAGGG + Intronic
990377869 5:55190927-55190949 ATCTACTAGCTGTGGGATGTAGG - Intergenic
992598663 5:78373096-78373118 TTCCACTAGCAGAGGGGAGAAGG - Intronic
993638093 5:90370209-90370231 CTTTATTAGCAGTGTGAAAATGG - Intergenic
994801369 5:104381240-104381262 CTTTATTAGCAGTGTGAAAATGG - Intergenic
995155849 5:108912190-108912212 CTTTATTAGCAGTGTGAAAACGG + Intronic
997274738 5:132575116-132575138 CTTTATTAGCAGTGTGAAAACGG - Intronic
998699766 5:144684820-144684842 CTTTATTAGCAGTGTGAAAATGG - Intergenic
999100292 5:149018355-149018377 CTTTATCAGCAGTGGGAAAATGG - Intronic
999305721 5:150518243-150518265 CTCTTCTGGCAGGGGGAAGGAGG - Intronic
999473896 5:151880160-151880182 CTTTATTAGCAGTGTGAAAATGG + Intronic
1001041550 5:168339268-168339290 CTCTAAGAGCAGAGGGATGAGGG + Intronic
1001144902 5:169175356-169175378 GTGTACTAGGAGTGGGAAGAGGG - Intronic
1001291663 5:170467471-170467493 CTTTACTACCAGTGGAAAGAAGG + Intronic
1002679844 5:180952726-180952748 CTCTACCAGCACTGGGGAGAAGG - Intergenic
1003006735 6:2389549-2389571 CTCTCCTCGCAGTGGCAAAATGG - Intergenic
1003911702 6:10749256-10749278 GTCTACTCACAATGGGAAGAGGG - Exonic
1004960896 6:20786808-20786830 TTTTTCTAGCAGTGGGAATACGG + Intronic
1005095438 6:22109811-22109833 CTCTACTACCTGTGCCAAGATGG - Intergenic
1005122196 6:22402023-22402045 CTTTAATAGCAGTGTGAAAATGG + Intergenic
1008260398 6:49359329-49359351 CTTTACCAGCGGTGTGAAGATGG + Intergenic
1008681293 6:53876031-53876053 CTTTACCAGCAGTGTGAAAATGG - Intronic
1008687334 6:53940267-53940289 CTTTATTAGCAGTGTGAAAATGG + Intronic
1009748781 6:67855851-67855873 CTTTACTAGCAGTGTGAGAATGG + Intergenic
1010275838 6:73967457-73967479 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1011833679 6:91404231-91404253 CTCCACAGGCAGGGGGAAGAAGG + Intergenic
1011834955 6:91420613-91420635 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1012749822 6:103144548-103144570 CTTTATTAGCAGTGTGAAAAAGG - Intergenic
1013147104 6:107404448-107404470 CTTTATTAGCAGTGGGAGAACGG - Intronic
1015518493 6:134108486-134108508 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1015676933 6:135761312-135761334 CTTTATCAGCAGTGGGAAAAAGG - Intergenic
1015735816 6:136398773-136398795 CTTTACCAGCAGTGGGAAAATGG + Intronic
1015916467 6:138222505-138222527 CACAACTGGCAGTGGGAAGGAGG + Intronic
1016128817 6:140440241-140440263 CAATACTAGCAATGGGAACAAGG - Intergenic
1016361310 6:143270215-143270237 CTCTGCTAAGTGTGGGAAGAGGG - Intronic
1017067797 6:150546338-150546360 ATCTAGTAGCAGTGGGTGGAAGG - Intergenic
1017204643 6:151791511-151791533 CTTTATTAGCAGTGTGAAAATGG + Intronic
1018396759 6:163383751-163383773 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1018666997 6:166147929-166147951 CCCTAATAGCAGTGGCAGGAAGG + Intergenic
1021400960 7:20209126-20209148 CTCTACTAGGGCAGGGAAGAAGG + Intronic
1021673224 7:23053759-23053781 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1022862436 7:34382342-34382364 CTTTACCAGCAGTGTGAAAATGG + Intergenic
1023266592 7:38412469-38412491 CGCTACTAGCAGTTGGTAGGTGG + Intronic
1023911509 7:44560047-44560069 CTGTTCCAGCAGTGGGGAGATGG - Intergenic
1024186047 7:46949031-46949053 CTCTCCAAGCATTCGGAAGAGGG + Intergenic
1024192339 7:47025342-47025364 TTCTACTAGCAGAAGGAAGTCGG + Intergenic
1024328181 7:48129928-48129950 CTCTATCAGCAGTGTGAAAATGG - Intergenic
1025117428 7:56270169-56270191 CTTTCCTGCCAGTGGGAAGATGG + Intergenic
1026241614 7:68580518-68580540 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1026302452 7:69109698-69109720 CTTTAATAGCAGTGTGAAAATGG - Intergenic
1028041946 7:86063958-86063980 CTCTACTAGGAGAGTGCAGAAGG + Intergenic
1029036930 7:97532354-97532376 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1029140909 7:98409271-98409293 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1030408449 7:109144008-109144030 CTCTTCCAGCAGTGGCAACATGG - Intergenic
1030703361 7:112666258-112666280 CTCTATCAGCAGTGTGAAAATGG - Intergenic
1030784380 7:113641767-113641789 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1030990885 7:116298563-116298585 CTATATTAGCAGTGTGAAAACGG + Intronic
1032299770 7:130675937-130675959 CTCAACTAGGAGTGGGGACACGG + Intronic
1032454201 7:132059456-132059478 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1032549485 7:132771308-132771330 ATCTACTAGCAACAGGAAGAGGG + Intergenic
1032718835 7:134533862-134533884 CTCTACTAGCATTTGCAAAAGGG - Intronic
1033013862 7:137651655-137651677 CTCTAACAGGAGTGGGCAGACGG + Intronic
1033095917 7:138430594-138430616 CTTTATTAGCAGTGGGAGAACGG + Intergenic
1033759825 7:144426507-144426529 CTTTACTAGCAGTGCAAAAATGG - Intergenic
1034948251 7:155278233-155278255 CGCAAACAGCAGTGGGAAGAAGG - Intergenic
1037036053 8:14168680-14168702 CTTTACTAGCAGTGTGAAAACGG + Intronic
1037127016 8:15363696-15363718 CTCTGGTATCATTGGGAAGATGG + Intergenic
1038512052 8:28147274-28147296 CTCCACAGGCAGTGGGAAGAGGG - Intronic
1038849876 8:31265335-31265357 CTTTACTAGCAGTGTGAGAACGG + Intergenic
1039037911 8:33379242-33379264 CTTTATAAGCAGTGGGAAAATGG + Intronic
1040741225 8:50578860-50578882 CTTAATTAGCAGTGTGAAGATGG + Intronic
1041334288 8:56762767-56762789 GACTACTAGAAGTGGGAGGAAGG - Intergenic
1042782236 8:72504591-72504613 CTTTACTAGCAGTGTGAAAACGG - Intergenic
1042992242 8:74654710-74654732 CTTTATTAGCAGTGTGAAAATGG + Intronic
1043739007 8:83784581-83784603 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1045249455 8:100471229-100471251 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1045681320 8:104663493-104663515 CTCAACTAGCAGTGGGACCTAGG - Intronic
1046003434 8:108448697-108448719 CTTTATCAGCAGTGGGAAAACGG + Intronic
1046090889 8:109501629-109501651 CTCCACTAACATTGGAAAGAAGG + Intronic
1046364186 8:113204797-113204819 CTTTATTAGCAGTGTGAAAATGG - Intronic
1046809859 8:118521315-118521337 CTCTGCTAGCAAAGGGATGAAGG - Intronic
1047561551 8:125992267-125992289 TTCTACTACCAGGGGTAAGAGGG + Intergenic
1048010961 8:130455769-130455791 ATCTACTTGGAGTGGGAAAAGGG - Intergenic
1048158688 8:131990998-131991020 CTCTATCAGCAGTGTGAAAATGG - Intronic
1048429457 8:134356191-134356213 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1050420152 9:5455490-5455512 TTCTACTAACAGTGGGGAGTGGG - Intronic
1050842672 9:10171831-10171853 CTTTATTAGCAGTGTGAAAATGG + Intronic
1051743490 9:20273726-20273748 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1051962088 9:22778976-22778998 GCCTACCAGCAGTGGGAGGATGG - Intergenic
1052067710 9:24043027-24043049 CACTACTAGCAGGAGGCAGAGGG + Intergenic
1052190857 9:25659679-25659701 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1052282871 9:26753029-26753051 CTTTACTAGCAGTGTGAAAACGG + Intergenic
1053533448 9:38904147-38904169 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1053698835 9:40666103-40666125 CTTTACCAGCAGTGTGAAAACGG + Intergenic
1054205673 9:62128576-62128598 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1054310124 9:63465504-63465526 CTTTACCAGCAGTGTGAAAACGG + Intergenic
1054408912 9:64789656-64789678 CTTTACCAGCAGTGTGAAAACGG + Intergenic
1054442070 9:65273470-65273492 CTTTACCAGCAGTGTGAAAACGG + Intergenic
1054488212 9:65748027-65748049 CTTTACCAGCAGTGTGAAAACGG - Intergenic
1054632688 9:67459794-67459816 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1055815125 9:80195826-80195848 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1056092103 9:83215631-83215653 CTTTACTAGCAGTGTGAGAACGG + Intergenic
1056526379 9:87446616-87446638 CTTTACAAGCAGTGTGAAAACGG + Intergenic
1056595045 9:88001122-88001144 CTTTACCAGCAGTGTGAAAATGG + Intergenic
1057705200 9:97390793-97390815 CTTTATTAGCAGTGTGAAAACGG - Intergenic
1057745030 9:97744432-97744454 CGTTACTAGCAGTGTGAAAACGG + Intergenic
1057782011 9:98057480-98057502 CACTACTAGCTGTGTGAACATGG + Intronic
1057809710 9:98248439-98248461 CCCCACCACCAGTGGGAAGAAGG + Intronic
1058106896 9:100982594-100982616 CTTTAGTAGCAGTGTGAAAACGG + Intergenic
1058190099 9:101903753-101903775 ATCTACTCTCAGTGGTAAGAAGG + Intergenic
1058337925 9:103855797-103855819 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1058583839 9:106485919-106485941 CTTTATTAGCAGTGTGAGGATGG + Intergenic
1058873877 9:109225329-109225351 CTTTACCAGCAGTGTGAAAACGG - Intronic
1059676622 9:116546540-116546562 CTGTCCTAGGAGTGTGAAGATGG + Intronic
1060593755 9:124835504-124835526 CTCTCCTAGGAGTGGGATCATGG - Intergenic
1060876083 9:127084516-127084538 CACAAAGAGCAGTGGGAAGAGGG - Intronic
1062299338 9:135856142-135856164 CTTTATCAGCAGTGTGAAGATGG - Intronic
1202781201 9_KI270717v1_random:39310-39332 CTTTACCAGCAGTGTGAAAACGG + Intergenic
1185973876 X:4696650-4696672 CTCTATTAGCAGTGTGAAAACGG - Intergenic
1186080269 X:5923439-5923461 CTCTATGAGCAGTGTGAAAATGG - Intronic
1186751769 X:12628820-12628842 CTTTATTAGGAGTGTGAAGACGG - Intronic
1187852528 X:23605331-23605353 CTTTATCAGCAGTGGGAAAATGG + Intergenic
1188913951 X:35887338-35887360 CCAAACCAGCAGTGGGAAGAGGG + Intergenic
1189270710 X:39749868-39749890 CACTCCTAGCAGTGGGAGGCTGG - Intergenic
1189382355 X:40511068-40511090 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1189619326 X:42818732-42818754 CTCCACCAGCAGAGGGCAGAGGG + Intergenic
1190497602 X:51041589-51041611 CTTTATTAGCAGTGTGAAAACGG - Intergenic
1191760907 X:64647265-64647287 CTCTACTAGCAAAGTGCAGAGGG + Intergenic
1191923025 X:66278000-66278022 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1192040904 X:67620415-67620437 CTCTAGTACCAAGGGGAAGATGG + Intronic
1192932707 X:75824955-75824977 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1193330194 X:80227264-80227286 GACTACTAGAAGTGGGAGGAAGG - Intergenic
1193863417 X:86699307-86699329 CTTTACTAGCAGTGTGAAAATGG - Intronic
1194300482 X:92180901-92180923 CTTTATTAGCAGTGTGAAAATGG + Intronic
1194721855 X:97349772-97349794 TTCTACTGGCAATGAGAAGAGGG + Intronic
1197128139 X:122972087-122972109 CTTTACTAGCAGTGTGAAAAAGG + Intergenic
1198595178 X:138228398-138228420 CTCTACTAGAATTGTGATGAGGG + Intergenic
1199742941 X:150752416-150752438 CTCTAACTGCAGTGGGAAGCAGG - Intronic
1200296623 X:154926254-154926276 CTTTATTAGCAGTGTGAAAATGG + Intronic
1201617532 Y:15918317-15918339 CTTTAGTAGCAGTGTGAAAATGG - Intergenic
1201634548 Y:16108013-16108035 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1201704481 Y:16921126-16921148 CTTTACCAGCAGTGTGAAAATGG - Intergenic