ID: 1089793724

View in Genome Browser
Species Human (GRCh38)
Location 11:120963493-120963515
Sequence TCTCTATGGTGTGTGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 0, 2: 1, 3: 71, 4: 507}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089793724_1089793726 -7 Left 1089793724 11:120963493-120963515 CCTTCACACACACACCATAGAGA 0: 1
1: 0
2: 1
3: 71
4: 507
Right 1089793726 11:120963509-120963531 ATAGAGAGCCCGTGCTGTAGAGG 0: 1
1: 0
2: 1
3: 4
4: 67
1089793724_1089793731 10 Left 1089793724 11:120963493-120963515 CCTTCACACACACACCATAGAGA 0: 1
1: 0
2: 1
3: 71
4: 507
Right 1089793731 11:120963526-120963548 TAGAGGGTTGTGCTGGTATGAGG 0: 1
1: 0
2: 0
3: 5
4: 131
1089793724_1089793733 26 Left 1089793724 11:120963493-120963515 CCTTCACACACACACCATAGAGA 0: 1
1: 0
2: 1
3: 71
4: 507
Right 1089793733 11:120963542-120963564 TATGAGGGTGTTCTTGTACAAGG 0: 1
1: 0
2: 0
3: 5
4: 116
1089793724_1089793732 11 Left 1089793724 11:120963493-120963515 CCTTCACACACACACCATAGAGA 0: 1
1: 0
2: 1
3: 71
4: 507
Right 1089793732 11:120963527-120963549 AGAGGGTTGTGCTGGTATGAGGG 0: 1
1: 0
2: 1
3: 10
4: 175
1089793724_1089793727 -6 Left 1089793724 11:120963493-120963515 CCTTCACACACACACCATAGAGA 0: 1
1: 0
2: 1
3: 71
4: 507
Right 1089793727 11:120963510-120963532 TAGAGAGCCCGTGCTGTAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1089793724_1089793730 3 Left 1089793724 11:120963493-120963515 CCTTCACACACACACCATAGAGA 0: 1
1: 0
2: 1
3: 71
4: 507
Right 1089793730 11:120963519-120963541 CGTGCTGTAGAGGGTTGTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089793724 Original CRISPR TCTCTATGGTGTGTGTGTGA AGG (reversed) Intronic
900241340 1:1618909-1618931 TCTCTAGGGGGTGTTTGTGGTGG - Intronic
900913800 1:5620417-5620439 TCTCTTTGGGGTGTGTGTGGTGG + Intergenic
900975870 1:6015987-6016009 TCTCTAGGGGCTGGGTGTGATGG - Intronic
901117903 1:6863484-6863506 TGTCTATGCTGAGTGTCTGATGG + Intronic
901192837 1:7422723-7422745 TGCCTATGGAGTGGGTGTGAGGG - Intronic
901204883 1:7488475-7488497 TGTGTATTGTGTGTGTGTGATGG - Intronic
901834957 1:11918106-11918128 TCCCCATGGTGTGCGTCTGATGG - Intergenic
902398250 1:16143965-16143987 TCCCTAGGGTGTGTGTGAAAGGG - Intronic
902728968 1:18356282-18356304 GCTCTCTGGGGTGTGTGTGGTGG - Intronic
902740849 1:18436962-18436984 TCTCTATGGTGGGCTTGGGATGG - Intergenic
902971363 1:20054338-20054360 CCTCTAGGGTGTGTCTGTCATGG + Intronic
903616962 1:24666758-24666780 TTTTTTTTGTGTGTGTGTGATGG - Intronic
903771510 1:25767256-25767278 TGTGTAATGTGTGTGTGTGAGGG - Intronic
903771574 1:25767622-25767644 TGTGTAATGTGTGTGTGTGAGGG - Intronic
903771718 1:25768459-25768481 TGTGTAATGTGTGTGTGTGAGGG - Intronic
903868785 1:26417343-26417365 ATTCGATGGTGTGTGTGTCAAGG - Intronic
904170595 1:28589858-28589880 TGTTTTTTGTGTGTGTGTGATGG + Intronic
904497271 1:30893970-30893992 TGTGTGTGGTGTGTGTGTGGAGG - Intronic
904837189 1:33346815-33346837 TCTCTATTGTGAATGTGTAAAGG - Intronic
905804831 1:40868854-40868876 TATCTGCGGTGTGTGTGTGGTGG + Intergenic
905874736 1:41424997-41425019 TATGTATGTTGTGTGTGTGGTGG + Intergenic
907256992 1:53186856-53186878 TCTCAGTGATGTGTGTGTGAGGG + Intergenic
907308492 1:53526509-53526531 TGTGTATGGTGTGTGAGAGAGGG - Intronic
907749790 1:57251912-57251934 TCTTTATGGGGTGTGTGTGCTGG - Intronic
907908378 1:58805775-58805797 TCCCAAAGGTATGTGTGTGAAGG - Intergenic
908081176 1:60580146-60580168 TCTCCATGGCTTGTGTGTGATGG + Intergenic
908761393 1:67515485-67515507 TGACCTTGGTGTGTGTGTGATGG + Intergenic
910342616 1:86204972-86204994 TGTGTGTGGTGTGTGTGTGTGGG - Intergenic
910481060 1:87658977-87658999 TCTATAAGGGGTGTGTGTGAAGG + Intergenic
910834714 1:91497132-91497154 TTTTTTTGGTGTGTGTGTGGGGG + Intergenic
910996909 1:93115680-93115702 TGATTATGGTGTGTGAGTGATGG + Intronic
911251795 1:95584939-95584961 TCTCTTTTCTGTGTGTGGGAGGG + Intergenic
912249456 1:107995710-107995732 TTTTTTTTGTGTGTGTGTGAGGG + Intergenic
912602486 1:110951160-110951182 TGTGTATAGTCTGTGTGTGATGG + Intronic
913437169 1:118859157-118859179 TATCTGTGGTGAGTGTGTGAGGG - Intergenic
914985179 1:152450156-152450178 TCTCTATCATGTGTGTAAGACGG - Intergenic
916724432 1:167510161-167510183 TATGTATGGTGTGTGTGTTTAGG - Intronic
917239852 1:172936427-172936449 TATTTTGGGTGTGTGTGTGAGGG - Intergenic
917333017 1:173901903-173901925 TCTCTATGGTGCTTATATGATGG + Exonic
918316332 1:183325746-183325768 TCACTATTGTTTGAGTGTGAGGG - Intronic
918825651 1:189320422-189320444 TCTGTGTGGTGTGTGTGTAGGGG - Intergenic
918825653 1:189320424-189320446 TCTCTGTGTGGTGTGTGTGTAGG - Intergenic
919673590 1:200360069-200360091 TTCCTATGGTGTGTTTGGGAAGG - Intergenic
919928336 1:202204813-202204835 TTTCGAGGGTGTGTGTTTGAAGG - Intronic
919928374 1:202205173-202205195 TTTCGAGGGTGTGTGTTTGAAGG - Intronic
920424641 1:205865316-205865338 ATTCCATGGTGTGTGTGTGTGGG - Intergenic
920571528 1:207021728-207021750 TGTGTTTGGTGTGTGTGTGGAGG - Exonic
920634715 1:207689372-207689394 TGTGTGTGGTGTGTGTGTGCAGG + Intronic
921312293 1:213856168-213856190 CCTCCACTGTGTGTGTGTGAGGG - Intergenic
923242033 1:232095704-232095726 TTTTTTTTGTGTGTGTGTGATGG + Intergenic
923570016 1:235104994-235105016 ACTCAAGGGTGTGTGTGTCAGGG + Intergenic
924853829 1:247857009-247857031 TTTCCTGGGTGTGTGTGTGACGG + Intergenic
1063171689 10:3515314-3515336 TCTAGCTGGTGTGTGTGTGGTGG - Intergenic
1063353989 10:5381177-5381199 TGTGTGTGGTGTGTGTGTGTGGG - Intergenic
1063561582 10:7133303-7133325 TTTCTATGATGTGTGTGGGAGGG - Intergenic
1063612254 10:7572642-7572664 TCTCCATGGTGTTTATGGGATGG + Intronic
1064114181 10:12563505-12563527 TATTTCTGGTGTGTCTGTGAGGG - Intronic
1065706473 10:28475640-28475662 TATTTTTGGTGTGTCTGTGAGGG + Intergenic
1066111177 10:32198373-32198395 TCTTTTTTGTGTGTGTGAGATGG - Intergenic
1067310806 10:45111796-45111818 TGTGTATGGGGTGTGTGTGGGGG + Intergenic
1067678505 10:48409082-48409104 TGTGTGGGGTGTGTGTGTGAGGG + Intronic
1069011795 10:63382205-63382227 TCTCTTCTGTGTGTGTGTGACGG - Intronic
1070836740 10:79452163-79452185 TATCTAATGGGTGTGTGTGATGG - Intergenic
1070904196 10:80057337-80057359 TGTCTAGGGTGTGTGAGGGAGGG - Intergenic
1071231220 10:83588467-83588489 TATTTAAGGTGTGTCTGTGATGG + Intergenic
1071290680 10:84186557-84186579 GATGTGTGGTGTGTGTGTGAGGG + Intergenic
1071713715 10:88074521-88074543 TGTCCACGATGTGTGTGTGATGG + Intergenic
1072031047 10:91522717-91522739 TCTGACTGGTGTGTGTGAGATGG - Intergenic
1072463885 10:95645565-95645587 TTTCTAAGATATGTGTGTGAAGG - Intronic
1073037036 10:100571218-100571240 TCTCAGTGTTGTGAGTGTGATGG + Intergenic
1073951920 10:108819211-108819233 TCTATATTGTGTGTGTGTCTGGG + Intergenic
1074332057 10:112523566-112523588 TGTGTATGTTGTGTGTGTGTGGG + Intronic
1075594400 10:123717671-123717693 TGTGTGTGGTGTGTGTGTGCAGG - Intronic
1075649979 10:124121087-124121109 TGTCTGTGGTGTGTGTATGGGGG + Intergenic
1076266232 10:129111736-129111758 CCTTTTTTGTGTGTGTGTGATGG - Intergenic
1076481999 10:130791006-130791028 TGTATGTGGTGTGTGTGTGTGGG - Intergenic
1076901310 10:133339663-133339685 TGTCTAGGGTGTATGTGTGAAGG - Intronic
1077004859 11:349650-349672 TGTGTGTGGTGTGTGTGTGTGGG - Intergenic
1077004907 11:350036-350058 TGTGTGTGGTGTGTGTGTGTGGG - Intergenic
1077004916 11:350109-350131 TGTGTATGGTGTGTGTGTGTGGG - Intergenic
1077142932 11:1032570-1032592 TGTGTAGGGTGTGTGTGTGTTGG + Intronic
1077680065 11:4231526-4231548 TCTCTATGGTCCTAGTGTGAGGG - Intergenic
1077681420 11:4244379-4244401 TCTCTATGGTCCTAGTGTGAGGG + Intergenic
1077689476 11:4328103-4328125 TCTCTATGGTCCTAGTGTGAGGG - Intergenic
1077820481 11:5733439-5733461 TAACTATGGTGTGTGTGTTGGGG - Intronic
1081086357 11:38806382-38806404 TTTCAAGGGTGTGTGTGTGGGGG + Intergenic
1081422785 11:42891259-42891281 ACACTCTGGTGTGTGTGTGTGGG - Intergenic
1081884079 11:46479690-46479712 TCTCAGGGTTGTGTGTGTGACGG - Intronic
1081961085 11:47138012-47138034 CCTCTAGGGTGTGTGTGTGTGGG - Intronic
1082607240 11:55255050-55255072 TCTCTCTAGTTTTTGTGTGAAGG + Intergenic
1083795204 11:65012931-65012953 TCTTCCTTGTGTGTGTGTGATGG + Intergenic
1084005751 11:66322755-66322777 TCTCTGTGGCTTGTGTGTGGTGG + Intergenic
1084381721 11:68817093-68817115 TGTGTGTGGTGTGTGTGTGTGGG + Intronic
1084381730 11:68817162-68817184 TGTGTGTGGTGTGTGTGTGTGGG + Intronic
1084644531 11:70447492-70447514 TCTCTGGAGTGTGGGTGTGATGG + Intergenic
1086196169 11:84142531-84142553 TGCCTCTGGTGTGTCTGTGACGG + Intronic
1086911069 11:92473300-92473322 TCTCACTTGTGTGTGTGTGTTGG + Intronic
1086921251 11:92589695-92589717 TATTTATGTTGTGTGTGTGGTGG - Intronic
1087043116 11:93820881-93820903 TCTCTATGGAGTGAGGGTGAGGG + Exonic
1087188058 11:95223177-95223199 TTTCTATTGTGTGTGTGTGGTGG - Intronic
1087535316 11:99436831-99436853 TCTCGATGTTGAGTGTATGAAGG - Intronic
1087864324 11:103205309-103205331 TCACTATGCTGTGTGTTTGGAGG + Intronic
1088653918 11:111980945-111980967 TCTCCATGGTCTGTGCGTGCAGG + Intronic
1088686889 11:112291248-112291270 TCTCAGTGCTGTGTGTGTAATGG + Intergenic
1089359211 11:117875230-117875252 TATGTGTGGTGTGAGTGTGAGGG + Intronic
1089793724 11:120963493-120963515 TCTCTATGGTGTGTGTGTGAAGG - Intronic
1090176771 11:124656930-124656952 TCTCTGTGGTGGGTGGGTGGGGG - Intronic
1090602249 11:128385395-128385417 GATCTTTGGTATGTGTGTGAGGG - Intergenic
1092486710 12:8908421-8908443 TTTCTTTTCTGTGTGTGTGACGG + Intergenic
1093010219 12:14099622-14099644 TATTTCTGGTGTGTCTGTGAGGG - Intergenic
1093659348 12:21736434-21736456 TATTTTTTGTGTGTGTGTGATGG - Intronic
1094661181 12:32471995-32472017 GCTCTATCGTGCATGTGTGAAGG - Intronic
1095753209 12:45732484-45732506 CATCTATTGTGTGTGTGTGATGG + Intronic
1096469124 12:51865187-51865209 TGACTATTGTGTGTGTGTGTGGG - Intergenic
1096873957 12:54612889-54612911 TCTCTTTAGTGTGTGTGGCAGGG + Intergenic
1097181904 12:57176455-57176477 TCACTATTGTGTGTGACTGAAGG - Intronic
1098476434 12:70909307-70909329 TATCTTTGATGTGTGTGTGGTGG - Intronic
1098480010 12:70946689-70946711 TCTTTGTGATGTTTGTGTGATGG - Intergenic
1099806794 12:87530328-87530350 TCTTTTTTTTGTGTGTGTGACGG - Intergenic
1100161802 12:91869185-91869207 TCTTTTTTGTGTGTGTGTGTTGG - Intergenic
1100988494 12:100227653-100227675 TTTTTGTTGTGTGTGTGTGACGG - Intronic
1101689438 12:107062621-107062643 CTTCTATGGTGTATGTATGAGGG - Intronic
1101709512 12:107251729-107251751 TGTTTCTGGTGTGTCTGTGAGGG - Intergenic
1101856712 12:108449892-108449914 TTTATTTTGTGTGTGTGTGAAGG + Intergenic
1102246420 12:111359276-111359298 TCTTTATTGTGTGTGTGTTTTGG + Intergenic
1102545330 12:113650396-113650418 TCTCTTGGATGTGTGTGTGTGGG + Intergenic
1102710229 12:114919560-114919582 TGTGTATGGTATGTGTGGGAAGG - Intergenic
1103007499 12:117433367-117433389 TGTGTATGGAGTGTGTGTAAGGG - Intronic
1103007512 12:117433498-117433520 TGTGTAAAGTGTGTGTGTGAGGG - Intronic
1103007538 12:117433811-117433833 TGTGTATGGAGTGTGTCTGAGGG - Intronic
1103078662 12:118005891-118005913 TCTTTTTTTTGTGTGTGTGATGG - Intergenic
1104054552 12:125219552-125219574 CCTCTGTTGTGTGTGTGGGAAGG + Intronic
1104463701 12:128973931-128973953 TGTGTAGGGTGTGTGTGTGTGGG + Intronic
1104501597 12:129291719-129291741 TGTGTATGGTGTGTGGGTGGAGG + Intronic
1104586895 12:130054792-130054814 TATGTGTGGTGTGTGTGTGGTGG - Intergenic
1105039656 12:132952959-132952981 TGTCTGGGGTGTGTGTGTGATGG - Intronic
1105765733 13:23557044-23557066 TGTGTATAGTGTGTGAGTGAGGG + Intergenic
1106364964 13:29069526-29069548 TATTTCTGGTGTGTCTGTGAGGG - Intronic
1106741305 13:32645964-32645986 TCACTTTGATGTGTGTGTGTGGG + Intronic
1106759627 13:32856042-32856064 TCACAATGGTGGGTGGGTGAGGG + Intergenic
1108704388 13:52972104-52972126 TGTGTGTGGTGTGTGTGTTAGGG + Intergenic
1109734826 13:66469031-66469053 TTTCTAAGTTGTGTGTGTGTGGG + Intronic
1109763498 13:66862336-66862358 TGTCTATAGTGTGTGGGTGTAGG + Intronic
1109865005 13:68252139-68252161 TCTTTTTTGTGTATGTGTGATGG - Intergenic
1110241454 13:73271680-73271702 TCACTATGCTTTGTGTGTGCTGG - Intergenic
1110317577 13:74128901-74128923 TGTGTATGGTGTGTGTGGGTGGG + Intronic
1110831773 13:80040158-80040180 TCTCTATGTTACGTGTGTTATGG + Intergenic
1111247222 13:85555221-85555243 TCTCTATGGTCATAGTGTGAAGG - Intergenic
1111407148 13:87823505-87823527 TCTATTTTGTGTGTATGTGATGG + Intergenic
1111469362 13:88657953-88657975 TCACTATGTTGTCTTTGTGATGG - Intergenic
1111479565 13:88806417-88806439 TGTTAATTGTGTGTGTGTGATGG + Intergenic
1111838494 13:93420027-93420049 GTTCTATCGTGTGTGTGTGTTGG - Intronic
1112814380 13:103254164-103254186 TCTATTTTGCGTGTGTGTGATGG - Intergenic
1113263539 13:108592407-108592429 TGTGTGTGGTGTGTGTGTGGAGG + Intergenic
1113327170 13:109293475-109293497 TGTGTAGGGTGTGTGTGTAAGGG - Intergenic
1114623196 14:24111375-24111397 TGTTTTTTGTGTGTGTGTGACGG + Intronic
1114693147 14:24604043-24604065 TGTGTGTGTTGTGTGTGTGAAGG - Intergenic
1115085012 14:29504894-29504916 TGTGTGTGGTGTGTGTGTGTTGG + Intergenic
1115348007 14:32363774-32363796 TTTCCTTGGTGTGTCTGTGAGGG - Intronic
1115595236 14:34902808-34902830 TCCCTATCGTGTGTCTGTGGTGG - Intergenic
1117203376 14:53414991-53415013 CCTGTAAGGTGTGTTTGTGAGGG + Intergenic
1117599522 14:57361211-57361233 ACTCTATGCTGTGTGTATGACGG - Intergenic
1117628510 14:57665142-57665164 TCTTTAAGGTGTGTGTGTGCGGG - Intronic
1117728422 14:58696691-58696713 TCTCTCTGGTGGTGGTGTGATGG + Intergenic
1118232022 14:63961239-63961261 TCACTATGGGGTATGTCTGAAGG - Intronic
1120494322 14:85215665-85215687 TCACTTTTGTGTGTGTGTGACGG + Intergenic
1120924223 14:89781967-89781989 TCTCTTAGATGAGTGTGTGATGG + Intergenic
1121608441 14:95258763-95258785 TATCTGTGGTGTGTGTGTGGAGG + Intronic
1121608452 14:95258874-95258896 TATCTGTGGTGTGTGTGTGGAGG + Intronic
1122690103 14:103528227-103528249 CCTCTGTGGAGTGTGTGTGCAGG - Intergenic
1122979811 14:105186410-105186432 TGTGTATGGGGTGTGTGTGTGGG + Intergenic
1122979851 14:105186546-105186568 TGTGTATGGGGTGTGTGTGTGGG + Intergenic
1122979891 14:105186682-105186704 TGTGTATGGGGTGTGTGTGTGGG + Intergenic
1123413348 15:20077401-20077423 TCTCTAGTGTGTGTGTGGGTGGG + Intergenic
1123503648 15:20915729-20915751 CCTTTATGGAGAGTGTGTGAGGG - Intergenic
1123522690 15:21084512-21084534 TCTCTAGTGTGTGTGTGGGTGGG + Intergenic
1123560895 15:21489403-21489425 CCTTTATGGAGAGTGTGTGAGGG - Intergenic
1123597135 15:21926694-21926716 CCTTTATGGAGAGTGTGTGAGGG - Intergenic
1124034971 15:26046475-26046497 TCTATATGGTGTGTGCTTGAGGG + Intergenic
1124168534 15:27351483-27351505 TGTGTATGGTGTGTGTGTGTTGG + Intronic
1124250677 15:28104783-28104805 TCTGTGGGGGGTGTGTGTGACGG + Intergenic
1124354204 15:28983344-28983366 TATTTGTGGTGTGTGTGTGGCGG + Intronic
1124415469 15:29470137-29470159 TGTCTGTGGTATGTGTGTGAAGG - Intronic
1124517078 15:30375675-30375697 TGTGTCTGGTGTGTGTGTGTTGG + Intronic
1124725840 15:32155042-32155064 TGTGTCTGGTGTGTGTGTGTTGG - Intronic
1125381128 15:39088135-39088157 TGTCTATGGAATGGGTGTGATGG - Intergenic
1126028329 15:44471117-44471139 AATGTATGTTGTGTGTGTGAAGG - Intronic
1126978094 15:54208601-54208623 TGTGTATGATGTGTGTATGATGG + Intronic
1128065808 15:64763790-64763812 TTCCAATGGTGTGTGTGTGTAGG + Intronic
1128185254 15:65639251-65639273 TCTGTGTGGTGTGTGGGTGAGGG + Intronic
1128657315 15:69471868-69471890 TCTGGATGGTATGTGTCTGATGG + Intergenic
1128810877 15:70571678-70571700 TCTCTGTGCTGTGTATGTCAGGG + Intergenic
1128875711 15:71199466-71199488 TGTGTGTGGTGTGTGTGTGTGGG + Intronic
1129455126 15:75672687-75672709 TCTCTGTGTTGTGTGTCTGAAGG + Intergenic
1129506207 15:76083592-76083614 TCTAGATGGTGTGGGGGTGAGGG - Intronic
1129883703 15:79023897-79023919 TCTGTGTGTGGTGTGTGTGAAGG - Intronic
1130653862 15:85778299-85778321 GCTCTCTGGTGGGTGAGTGAAGG - Intronic
1132056741 15:98656542-98656564 TATGTATTTTGTGTGTGTGATGG - Intronic
1202969240 15_KI270727v1_random:216567-216589 CCTTTATGGAGAGTGTGTGAGGG - Intergenic
1133554973 16:6897396-6897418 TTCCTTTTGTGTGTGTGTGACGG - Intronic
1134111750 16:11519332-11519354 TCACCATGGGGTGTGTGTGGTGG + Intronic
1134470480 16:14520883-14520905 TCTTTATAGTGTGTGTGTCTTGG + Intronic
1134655617 16:15946424-15946446 TCACTCTGGTGGGTGTATGATGG + Intergenic
1135845400 16:25913973-25913995 TGTATGTGGTGTGTGTGTGCAGG + Intronic
1136115138 16:28089681-28089703 TGTGTGTGGTGTGTGTGTGCGGG - Intergenic
1136405672 16:30045269-30045291 TGTGTGTGGTGTGTGTGTGGTGG + Intronic
1137279548 16:46964065-46964087 TCTTTTTTGTGTGTGTGTGACGG - Intronic
1138346027 16:56320765-56320787 GCTCTCTGCTGTGTGTGTGAGGG - Intronic
1138529336 16:57626704-57626726 TCTGTGGGGTGTGTGTGTGGTGG + Intronic
1139599800 16:67979858-67979880 TCTATATGGTCTGTGTGAGGAGG - Intronic
1139944251 16:70628130-70628152 ACTCTAGGGTGTGTGTGTAGTGG + Intronic
1140118179 16:72060821-72060843 TGAGTATGGTGTGTATGTGAAGG + Exonic
1140120213 16:72077012-72077034 TGAGTATGGTGTGTATGTGAAGG + Exonic
1140136246 16:72208147-72208169 TATCTTGGGTGTGTGTATGAGGG - Intergenic
1141099036 16:81183580-81183602 TCTCTATAATGTCTCTGTGAAGG + Intergenic
1141536198 16:84682028-84682050 TTACTCTGGTGTGTCTGTGAGGG + Intergenic
1141712236 16:85706568-85706590 TATGTGTGGTGTGTGTGTGTGGG - Intronic
1142592382 17:1012052-1012074 TCTCCAGGGTGTGTGTGTGCTGG - Intronic
1142713776 17:1737209-1737231 TGAATATGGTGTGTGTGGGAGGG + Intronic
1142875755 17:2851426-2851448 TCTGTGGGGTGTGGGTGTGATGG + Intronic
1144049933 17:11489881-11489903 ATTCTTTGCTGTGTGTGTGATGG - Intronic
1145861544 17:28215255-28215277 TCTTTTTTGGGTGTGTGTGAGGG - Intergenic
1147394674 17:40132630-40132652 TTTTTTTTGTGTGTGTGTGATGG - Intronic
1148789801 17:50166816-50166838 TGTGTGGGGTGTGTGTGTGACGG - Intronic
1149458663 17:56809988-56810010 TGTCTGGGGTGTGTGTGTGAAGG - Intronic
1150359523 17:64519076-64519098 ACTCTAGGGTGTGGGAGTGAAGG - Intronic
1150580252 17:66467051-66467073 TCTCTGTCGTGTGTGTTTGCAGG - Intronic
1151275216 17:73029111-73029133 TTTTTTTTGTGTGTGTGTGACGG - Intronic
1152394641 17:80025153-80025175 TGTCTATGGTGTGTGTGTCCTGG - Intronic
1153277316 18:3380234-3380256 TTTCTTTTGTGTGTGTGTGGTGG - Intergenic
1154268901 18:12902259-12902281 TATTTCTGGTGTGTCTGTGAGGG + Intronic
1155673243 18:28397350-28397372 TCCCACAGGTGTGTGTGTGAGGG + Intergenic
1155814216 18:30284161-30284183 TATCTCTGGTATGTCTGTGAGGG - Intergenic
1156187630 18:34681732-34681754 TCCATAGGGTGTGTGTGTGTGGG - Intronic
1157674681 18:49560577-49560599 ACTCAATGGTCTGTGTGCGATGG - Intergenic
1157818282 18:50746929-50746951 TCTCAATGGTGTGGCTGTTAAGG - Intergenic
1158704837 18:59783032-59783054 TTTCTGTTATGTGTGTGTGATGG - Intergenic
1159016211 18:63103582-63103604 TCTGTGTGTTGTGTGTGTGTGGG + Intergenic
1159333026 18:67026155-67026177 TTTCTATGATATTTGTGTGATGG + Intergenic
1160240397 18:77118589-77118611 TGTCTGTGGAGTGTGTGTGTGGG - Intronic
1160302968 18:77703363-77703385 TCTCTAAGGAGTGTGTGGGCCGG + Intergenic
1160415024 18:78703755-78703777 TGTGTGTGGTGTGTGTGTGTTGG + Intergenic
1160415063 18:78704030-78704052 TGTCTATAGTGTGTGTGTTGGGG + Intergenic
1160977073 19:1797971-1797993 TCTTTTGTGTGTGTGTGTGATGG + Intronic
1161150405 19:2704980-2705002 TCTTTTTTGTGTGTGTGAGATGG + Intergenic
1161905444 19:7153052-7153074 TGTGTGTGGTGTGTGTGTGTGGG - Intronic
1162634100 19:11953069-11953091 TTTTTTTTGTGTGTGTGTGATGG - Intronic
1164504302 19:28846135-28846157 TCTCTATTGTGCGTGTGTATGGG + Intergenic
1165057154 19:33184929-33184951 TCCTTTTTGTGTGTGTGTGACGG + Intronic
1165238882 19:34447336-34447358 GGTCTTGGGTGTGTGTGTGAGGG - Intronic
1165477240 19:36038228-36038250 TCACTATGGTCTGTGTGCGGTGG - Intronic
1166118823 19:40672649-40672671 TCTCCATGCAGTGTGTGTCATGG - Intronic
1166302365 19:41918665-41918687 TGTGTGTGGTGTGTCTGTGATGG - Intronic
1166445691 19:42855961-42855983 TCTCTTCTGTGTGTGTGTGGGGG - Intronic
1166687824 19:44806659-44806681 ACTCTATGGCATGTGTATGAAGG - Intergenic
1167116359 19:47491363-47491385 TCTGTGGGGTGTGTGTGTGTGGG + Intronic
1167824468 19:51959682-51959704 TTTCTATGTTTTGTTTGTGACGG - Intergenic
1168305789 19:55434428-55434450 TGTGTGTGGTGTGTGTGTGTGGG + Intronic
1168305877 19:55435379-55435401 TATATGTGGTGTGTGTGTGTGGG + Intronic
1168503428 19:56912831-56912853 TTTCTAATGTGTGTGTGTGTGGG - Intergenic
925149388 2:1604664-1604686 TCTGTGTGTTGTGTGTGTGTAGG - Intergenic
925684245 2:6455245-6455267 TCTTTATTTTGTGTGTGTGAGGG - Intergenic
925976274 2:9144237-9144259 TGTGTGTGGTGTGTGTGTGGGGG - Intergenic
926773012 2:16394534-16394556 TCTCTATGCTGTGTGGGGGCGGG - Intergenic
926773101 2:16395754-16395776 TCTCTATGGTGCTTGTGGCATGG - Intergenic
927245477 2:20954127-20954149 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
927559189 2:24057375-24057397 TTTTTTTTGTGTGTGTGTGATGG + Intronic
928196010 2:29217094-29217116 TCTATGTGGTGTGTCTGTGGGGG + Intronic
928699350 2:33883066-33883088 CCTTTCTGGTGTGTCTGTGAAGG + Intergenic
929425698 2:41842537-41842559 CCTCTGGGGAGTGTGTGTGAAGG - Intergenic
929573808 2:43039858-43039880 TTGCTGTGGTGTGTGTGGGAGGG - Intergenic
929615666 2:43305484-43305506 TTTCCAAGGGGTGTGTGTGATGG - Intronic
929966609 2:46542000-46542022 TCTGGCTGGTGTGTGTGTGGAGG + Intronic
930007933 2:46912997-46913019 TCAATTTGGTGTGTGTGTGTTGG + Intronic
930606841 2:53501818-53501840 TCTTTTTTCTGTGTGTGTGATGG + Intergenic
932300690 2:70665004-70665026 CCTGTGTGGTGTGTGTGTGATGG + Intronic
932570832 2:72937527-72937549 GCTGTCTGGGGTGTGTGTGAGGG + Intergenic
932956985 2:76363761-76363783 ACTCCTTGGTGTGTCTGTGAGGG + Intergenic
933078351 2:77956951-77956973 TTTCTTGGGTGTGTCTGTGAGGG - Intergenic
935408202 2:102731865-102731887 TATCTATGATGTGTTGGTGACGG + Intronic
935675699 2:105593546-105593568 TCTGTATGGTGTGTTTTTAATGG + Intergenic
936580836 2:113699126-113699148 TATTTCTGGTGTGTTTGTGAGGG - Intergenic
936678198 2:114739652-114739674 TCTTTTTTTTGTGTGTGTGATGG - Intronic
936729319 2:115361196-115361218 TCTCTGTGGTCTGAGAGTGAGGG + Intronic
937248957 2:120511393-120511415 TCTCTTTGAGGTGTGTGTGTTGG - Intergenic
937390155 2:121478936-121478958 TGTGTGTGGTGTGTGTGTGGGGG - Intronic
937655627 2:124371960-124371982 TATATCTGGTGTGTCTGTGAGGG + Intronic
937767905 2:125683073-125683095 TGTGTGTGGTGTGTGTGTGCAGG - Intergenic
942431701 2:175918478-175918500 TCTATATGCTGTCTGTGTGCTGG - Intergenic
942893893 2:181026430-181026452 TCTCTATCTTGTTTGTCTGAAGG + Intronic
943239747 2:185367238-185367260 GATCCATGGTGTGTCTGTGAGGG + Intergenic
943744534 2:191448006-191448028 TCTCACTTGTGTGTATGTGAGGG - Intergenic
944263384 2:197697856-197697878 TTTCTAGTGTGTGTGTGTAACGG + Intronic
945878692 2:215304802-215304824 GCTTTATTGTGTGTGTGTGGCGG - Intergenic
945964137 2:216167546-216167568 TCTCTCTCGTGTGTGTGTGTGGG + Intronic
946150540 2:217764354-217764376 ATTCCATGGTGTGTGTGTGGTGG + Intergenic
946954919 2:224919062-224919084 TATGTGTGGTGTGTGTGTGTGGG + Intronic
947662908 2:231883163-231883185 TTGCTATTGTGTGTGTGTGGGGG + Intergenic
948367207 2:237464698-237464720 TGTGTGTGGTGTGTGTGTGTGGG + Intergenic
948563903 2:238871475-238871497 TGTGTGTGGTGTGTGTGGGAGGG - Intronic
948579829 2:238978808-238978830 TCGGTCTGGTGGGTGTGTGATGG + Intergenic
948682324 2:239643859-239643881 TGTATATGGTGTGTATGTGTGGG + Intergenic
948716554 2:239869268-239869290 TGTCTGTGGTGTGTGTGAGGAGG - Intergenic
1170161665 20:13319739-13319761 CCTCTAGAGTGTGTGTGTGCAGG - Intergenic
1171109994 20:22472038-22472060 TGTATATGGTATGTGTGTGGTGG - Intergenic
1171911353 20:30960493-30960515 TCTGTATGTTGTTTATGTGAAGG + Intergenic
1172904104 20:38356105-38356127 TGTGTGTGGTGTGTGTGTGCTGG - Intronic
1173261904 20:41443917-41443939 TGTCTATGGTGGGTGTGTTGGGG + Intronic
1173686352 20:44926229-44926251 TCTATTTTTTGTGTGTGTGATGG + Intronic
1174136843 20:48385649-48385671 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
1175127006 20:56759941-56759963 TTTCAGTGGGGTGTGTGTGATGG + Intergenic
1177040013 21:16096410-16096432 TATTTCTGGTGTGTCTGTGAGGG - Intergenic
1178505489 21:33159315-33159337 AATTTCTGGTGTGTGTGTGAAGG - Intergenic
1178511089 21:33205752-33205774 TCTCTATGGAGTGTGGGTATTGG - Intergenic
1179279227 21:39920038-39920060 TATGTGTGGTGTGTGTGTGTAGG + Intronic
1179769738 21:43605777-43605799 TGTTTATGGTGTGAGTGTGAGGG - Intronic
1179798337 21:43798639-43798661 TCTGTGTGCAGTGTGTGTGAGGG + Intronic
1180009894 21:45042701-45042723 TGTGTGTGGTGTGTGTGTGGTGG + Intergenic
1180986834 22:19909845-19909867 TGTGTGTGGTGTGTGTGTGAAGG - Intronic
1181428659 22:22862672-22862694 TTTCTATAGTGTGTGTCTGCAGG - Intronic
1181826593 22:25521333-25521355 TATTTCTGGTGTGTCTGTGAGGG - Intergenic
1181921928 22:26327329-26327351 TGTGTGTGGTGTGTGTGTGGGGG - Intronic
1183062235 22:35343329-35343351 TGTGTGTGGTGTGTGTGTGGGGG - Intronic
1183267488 22:36838178-36838200 TGTGTGTGGTGTGTGTGTGTGGG + Intergenic
1183547183 22:38460608-38460630 GCTCCATGGTGTGTGTGTGCAGG - Intergenic
1183584842 22:38747021-38747043 TCTTTTTTGTGTGTGTGTGATGG - Intronic
1183813242 22:40275975-40275997 TTTTTTTGGTGTGTGTGTGGGGG - Intronic
1184399393 22:44264985-44265007 TCTCTGTTGTGTGTGTGTTAAGG - Intronic
1184399396 22:44265010-44265032 ACACTCTGGTGTGTGTGTGTTGG - Intronic
1184748012 22:46467303-46467325 TGTCTTTGGTGTGTGTGTTTGGG - Intronic
1184880961 22:47303934-47303956 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
1185119371 22:48956866-48956888 TGTGTGTGGTGTGTGTGTGGGGG - Intergenic
1185169856 22:49286399-49286421 ACTCAGTGCTGTGTGTGTGATGG + Intergenic
950666950 3:14503497-14503519 TCACTCTGGTGTGTGTGCAATGG - Intronic
952818963 3:37469374-37469396 TGTCCATGCTGTGTGTGTGGTGG + Intronic
953687893 3:45092580-45092602 TCTCTGAGGTGTGAGTGGGAGGG - Intronic
953869960 3:46617965-46617987 TTTCTGCAGTGTGTGTGTGAGGG - Intronic
953907289 3:46874730-46874752 TCCCTATTGTGTGTGTGGGGGGG - Intronic
953967503 3:47321001-47321023 TCTCTGAGGTGTGTGTCTGAAGG + Intronic
955333251 3:58064850-58064872 TCTGTGTGGTGTGTGTGTGGCGG - Intronic
955588689 3:60510717-60510739 TTTCTATATTGTGTGTGTGGGGG - Intronic
958487392 3:94730063-94730085 TATCTTAGGTGTGTCTGTGAGGG - Intergenic
958700508 3:97582752-97582774 TCTATATGGTGTGGATGAGATGG - Intronic
960320302 3:116226677-116226699 TCTCTTTGTTGTATGTGTAATGG + Intronic
960572400 3:119198095-119198117 TCCCTATAATTTGTGTGTGAGGG - Intronic
962588425 3:136864481-136864503 TTTTTTTTGTGTGTGTGTGACGG - Intronic
964526735 3:157622665-157622687 TCACTTTTGTGTGTGTGTGGTGG + Intronic
964659979 3:159109645-159109667 TTTCTTTGGTGTGGGTGTGTGGG + Intronic
965136701 3:164782351-164782373 TTTTTTTTGTGTGTGTGTGATGG + Intergenic
965769663 3:172168663-172168685 TTTCTATCATGTCTGTGTGATGG + Intronic
965919017 3:173889967-173889989 TCTCTTTTGTGTATGTATGAGGG + Intronic
966925753 3:184643569-184643591 TGTCTTTGGGGTGTGTGTGTTGG + Intronic
967029121 3:185589302-185589324 TTTCTTTTGTGTGTGTGTAAGGG - Intronic
967123478 3:186404661-186404683 TGTGTCTGGTGTGTCTGTGAGGG - Intergenic
967495781 3:190143715-190143737 TTTGTATTGTGTGTGTGTGAGGG + Intergenic
967511630 3:190320058-190320080 TCTCTAAAGTGTGTGTGGGGGGG + Intronic
967853145 3:194097245-194097267 TGTGTGTGGTGTGTGTGTGTAGG + Intergenic
968539357 4:1155683-1155705 TGTGTGTGGTGTGTGTGTGTTGG - Intergenic
968631196 4:1652937-1652959 TCTGTGTGGTATGTGTGTGGTGG - Intronic
969687935 4:8686886-8686908 TGTGTGTGGTGTGTGTGTGGAGG + Intergenic
969848329 4:9937101-9937123 TTTCTATGTTGTGCCTGTGATGG - Intronic
970038972 4:11774187-11774209 TCCCTACCGTGTGTGTTTGATGG + Intergenic
970244473 4:14045238-14045260 TCTTGATTGTGTGTGTGTAAGGG + Intergenic
970293570 4:14603533-14603555 TCTTTTTTGTGTGTGTTTGAGGG - Intergenic
972238076 4:37157479-37157501 TCTTTCTGGTGTGTCTGTGAGGG + Intergenic
972310149 4:37873920-37873942 TCTCTCTGTTGAGTGTGTGTGGG + Intergenic
972387835 4:38585126-38585148 TTTTTTTTGTGTGTGTGTGATGG - Intergenic
972790211 4:42364476-42364498 TCTCTGTGAAGTGTGGGTGAGGG - Intergenic
973030130 4:45327126-45327148 TATTTCTGGTGTGTCTGTGAGGG - Intergenic
973265509 4:48206605-48206627 TTTCTCTGGTGTGTGTGTAGTGG - Intronic
973622739 4:52743614-52743636 GCTTTATGGTGTGTGTCTTAAGG + Exonic
974066375 4:57081390-57081412 GGTCTATGGTGTGAGTGGGAGGG - Intronic
974386955 4:61213618-61213640 TCTGTATTGTGTGTGTTTAATGG + Intronic
974711265 4:65598944-65598966 TGTATAAAGTGTGTGTGTGAAGG + Intronic
974813598 4:66977472-66977494 TTAGAATGGTGTGTGTGTGAAGG - Intergenic
976004737 4:80416215-80416237 ACTGTAGGGTGTGTTTGTGATGG + Intronic
977106817 4:92896745-92896767 TTTCTTTTGTGTGTGTGAGACGG + Intronic
977135615 4:93300113-93300135 TTCCTTTTGTGTGTGTGTGATGG + Intronic
978552610 4:109943890-109943912 TCTCGATGGTGTGGGAGTGAAGG + Exonic
979004298 4:115270664-115270686 TCTCTCTCGTGTGTGTGTGTGGG + Intergenic
979774580 4:124573200-124573222 TCTGTGTGGTGTGTCTGTGAGGG - Intergenic
980530198 4:134043156-134043178 TGTATATGGTGTGTGGGTGTAGG - Intergenic
980961541 4:139480982-139481004 TCTTTTTTGTGTGTGTGTGATGG + Intergenic
981857098 4:149307696-149307718 TATTTCTGGTGTGTCTGTGATGG + Intergenic
982123732 4:152166361-152166383 CTTCTGGGGTGTGTGTGTGAGGG - Intergenic
983449586 4:167894243-167894265 CCTCTCAGATGTGTGTGTGATGG - Intergenic
984579630 4:181496649-181496671 TTACTATGGCGTGTGTTTGAAGG + Intergenic
984700039 4:182813288-182813310 TCTATGTGGTGTGTGTGGTAAGG - Intergenic
984756683 4:183331382-183331404 TCTCCCTGGTGAGTGTCTGAGGG - Intergenic
986296983 5:6447678-6447700 TGTTTGTGGTGTGTGTGTGAGGG - Intergenic
986326810 5:6681956-6681978 TGTGTATCGTGTGTGTGTGTGGG + Intergenic
986524745 5:8662100-8662122 ACTTTAGGGTGTGTCTGTGAAGG + Intergenic
986777534 5:11031592-11031614 TGTTTCTGGTGTGTCTGTGAGGG + Intronic
986793041 5:11181926-11181948 TGTGTGTGGTGTGTGTGTGGGGG + Intronic
988081010 5:26415888-26415910 ACTCTATGATGTCTGTGTCATGG + Intergenic
988527970 5:32002905-32002927 TGTGTGTGGTGTGTGTGTGGTGG - Intronic
988527976 5:32002965-32002987 TGTGTGTGGTGTGTGTGTGTTGG - Intronic
988528007 5:32003235-32003257 TGTGTGTGGTGTGTGTGTGAAGG - Intronic
988572431 5:32382333-32382355 TTTCTTTTTTGTGTGTGTGAGGG - Intronic
988623042 5:32842989-32843011 CTTCTAGGGTGTGTGTGTGTTGG + Intergenic
989025064 5:37058351-37058373 TTTGTGTGGTGTGTGTGTGTGGG - Intronic
989873930 5:46651529-46651551 TCTCTCTAGTTTGTATGTGAAGG - Intergenic
990390705 5:55317047-55317069 TTTCTAGGGTGTGTGTGTGTGGG - Intronic
992788901 5:80196313-80196335 TCGCTATAGTGTGTGTGAGGTGG - Intronic
993428806 5:87804860-87804882 TATCTATTTTTTGTGTGTGATGG + Intergenic
994070183 5:95592551-95592573 TTTTTTTTGTGTGTGTGTGATGG + Intronic
994140104 5:96332788-96332810 CCTCAATGGGGTGTATGTGAAGG - Intergenic
994931936 5:106200128-106200150 TATTTATGGTGTGTGTGGGAGGG - Intergenic
995631588 5:114139465-114139487 CCTTTCTGGTGTGTGTGTGTGGG - Intergenic
996621066 5:125503746-125503768 GATCTATTGTGTGTATGTGATGG - Intergenic
997514269 5:134475466-134475488 GCTCAATGGTGTGTGTGTGTGGG + Intergenic
997541746 5:134668720-134668742 TTTTTTTTGTGTGTGTGTGATGG - Intronic
997826460 5:137111161-137111183 TCTCCATGGTGTGAGGGTCAAGG + Intronic
998091304 5:139371956-139371978 TGTCTATGGTTTTTGTGGGAGGG - Intronic
998187508 5:139993106-139993128 TGTGTGTGGTGTGTGTGTGGTGG + Intronic
999178974 5:149655395-149655417 TGTGTGTGGTGTGTGTGTGGGGG - Intergenic
1000367366 5:160504318-160504340 TGTGTATGGTGTATGTGTGTGGG + Intergenic
1000936586 5:167309030-167309052 TCTATATTGTGTGTGTTTGGTGG + Intronic
1001789938 5:174447465-174447487 TCTCTTCAGTGTGTGTGTGTTGG - Intergenic
1001832730 5:174803159-174803181 ACTCTTGGGTGTGTCTGTGAAGG + Intergenic
1002025449 5:176393555-176393577 CCTCCAAGGTGTGTATGTGATGG + Intronic
1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG + Intergenic
1002633322 5:180594967-180594989 TGTGTGTGGGGTGTGTGTGAGGG + Intergenic
1003350624 6:5314310-5314332 TATGGATGGTGTGGGTGTGATGG + Intronic
1003370259 6:5518092-5518114 GCTCTAGGCTGTGTGGGTGATGG + Intronic
1004286887 6:14329493-14329515 TGTGTGTGGTGTGTGTGTGCAGG - Intergenic
1005853153 6:29838098-29838120 TCTCTCTGTTGTGTGGGTGATGG - Intergenic
1006700476 6:35968802-35968824 GCTCCTTGGTGTGTGTGTGCGGG - Intronic
1007057493 6:38902327-38902349 TCTATCTGGTGGGTGTGTGGTGG + Intronic
1007103659 6:39268630-39268652 TCAGGGTGGTGTGTGTGTGAGGG + Intergenic
1007148862 6:39667511-39667533 TCTTTTGGGTGTGTCTGTGAGGG - Intronic
1007579135 6:42945534-42945556 GCTCCATGTTGTGTGTTTGAGGG + Intergenic
1008198516 6:48556316-48556338 TCTCTAATGTGTATGTGTCAGGG - Intergenic
1008221790 6:48863215-48863237 TCTTTTTTTTGTGTGTGTGATGG - Intergenic
1008379353 6:50824237-50824259 CCACTATGGGGTGTGTGTGTTGG - Intronic
1008639805 6:53450171-53450193 TCTCTGGGGTGTGGGTGTGGTGG + Intergenic
1008742840 6:54630582-54630604 TTTCTGGGGTGTGTCTGTGAGGG + Intergenic
1009524243 6:64723343-64723365 TCTCTATGTTGTTTTTGTAAAGG + Intronic
1009993016 6:70866660-70866682 TCTGTACGGTGTGTGTGTGTTGG - Intronic
1010462228 6:76126490-76126512 TATCCATTGTGTGTGTGGGATGG - Intergenic
1010745973 6:79562206-79562228 TATGTGTGGTGTGTGTGTAATGG - Intergenic
1011783956 6:90823111-90823133 TCCCTCTGGTGGGTGTGGGAAGG - Intergenic
1012398877 6:98828289-98828311 TGTGTGTGGTGTGTGTGTGTTGG - Intergenic
1013513187 6:110861842-110861864 TCTTTTTTTTGTGTGTGTGATGG - Intronic
1014120393 6:117718907-117718929 TGATTAGGGTGTGTGTGTGAAGG + Intergenic
1014417997 6:121208093-121208115 TTTTTTTGGTGTGTGTGTGAGGG - Intronic
1015295566 6:131588044-131588066 TATATAAGGGGTGTGTGTGAGGG - Intronic
1015643320 6:135362096-135362118 ATTCCATGGTGTGTGTGTGTAGG + Intronic
1016013376 6:139161036-139161058 TGTGTGTGGTGTGTGTGTGTCGG + Intronic
1016612020 6:146000466-146000488 TCTGGATGGAGTGTGTGTGGAGG + Intergenic
1016735839 6:147479204-147479226 TATTTCTGGTGTGTCTGTGAGGG - Intergenic
1016869690 6:148804373-148804395 TCTGCACTGTGTGTGTGTGAGGG + Intronic
1017334528 6:153239833-153239855 TCTCTTTGTTGTGTGTTAGATGG + Intergenic
1017704972 6:157113741-157113763 TCCCTTTTGTGTGTGTGTGTTGG + Intronic
1018920767 6:168171070-168171092 TCTTCATGGTGGGTGTGGGATGG + Intergenic
1019482946 7:1274716-1274738 GCTCTGTGGTGTGTGTGGGGGGG + Intergenic
1019510439 7:1414990-1415012 TGTGTTTGGTGTGTGTGTGAGGG - Intergenic
1020968162 7:14899450-14899472 ACTCTTTGGGGTGTGTGTGTAGG - Intronic
1021148718 7:17122274-17122296 TCTGTATGGTATGTGTGATATGG + Intergenic
1021862299 7:24918206-24918228 TTGCTATGGTGTTTATGTGATGG - Intronic
1021864413 7:24940822-24940844 TTTTTTTTGTGTGTGTGTGACGG + Intronic
1022498958 7:30870845-30870867 TCTCTTTGGGGTGTGGTTGAAGG + Intronic
1022926478 7:35060134-35060156 TCTGTGTGGTGTGTGTCTGTGGG + Intergenic
1023079700 7:36515353-36515375 TGTGTGTGGTGTGTGTGTGGGGG - Intronic
1023463322 7:40425172-40425194 TAAATATTGTGTGTGTGTGAGGG + Intronic
1024732030 7:52263594-52263616 TCTCTATAGGAAGTGTGTGATGG + Intergenic
1024772955 7:52745746-52745768 TTTTTTTTGTGTGTGTGTGATGG - Intergenic
1024961258 7:54979264-54979286 TCTTTATGGTGTATACGTGATGG + Intergenic
1025981530 7:66411203-66411225 TCTTTTTTGTGTGTGTGTAATGG - Intronic
1026256802 7:68719309-68719331 TCTCTAGGTTCTGTGGGTGAAGG + Intergenic
1026659220 7:72284429-72284451 TCTCTGTGATGTGTCTGTGAGGG + Intronic
1027533201 7:79361652-79361674 TCTCTCTTGTGAGTGTGTTATGG - Intronic
1027699804 7:81455981-81456003 TCAGTCTGGTGTGTGTGTGGGGG + Intergenic
1027956877 7:84890077-84890099 GCACGATAGTGTGTGTGTGAGGG - Intergenic
1028188341 7:87816414-87816436 TCTTTCTCGTGTGTGTGTGGGGG + Intronic
1028375788 7:90145410-90145432 TCTGTGTGGTGTGTGTCTGTGGG - Intergenic
1028619919 7:92813926-92813948 TCACTGTGGTGTGTTTTTGATGG - Intronic
1028726704 7:94096365-94096387 TGTGTATAGTGTGTGTGTGTGGG - Intergenic
1029016830 7:97324165-97324187 TCTTTTTTGTGTGTGTGTGATGG - Intergenic
1029824484 7:103174828-103174850 TCTGTGTGGTGTGTGTCTGTGGG + Intergenic
1029975765 7:104831701-104831723 TCTTTTTTTTGTGTGTGTGAAGG - Intronic
1029977989 7:104852100-104852122 GCTCTTTGGGGTGTGTGTGAGGG - Intronic
1030272568 7:107686087-107686109 TCTCTGTGGTGTGTGTGTGTGGG + Intronic
1031039748 7:116826985-116827007 TCTTTTTTGTGTGTGTGTGATGG + Intronic
1031676033 7:124613483-124613505 TTTCTAGTTTGTGTGTGTGAAGG - Intergenic
1033092614 7:138400335-138400357 GCTCTGTGGTTTGGGTGTGATGG - Intergenic
1033340345 7:140487130-140487152 TCTTTTTTGTGTGTGTGAGATGG - Intergenic
1033491520 7:141848026-141848048 TGCCTACTGTGTGTGTGTGATGG - Intergenic
1033586686 7:142779601-142779623 TCTGGGTGGTGTGTGTGTGGGGG - Intergenic
1033712443 7:143961940-143961962 TGGCTCTGTTGTGTGTGTGAAGG - Intergenic
1033733872 7:144203560-144203582 TCTCTATGGTTTGTATCTGTGGG + Intergenic
1033749178 7:144347413-144347435 TCTCTATGGTTTGTATCTGTGGG - Intergenic
1034203170 7:149294969-149294991 TCTCGCTGATGTGTGTGTGCCGG - Intronic
1034341493 7:150359522-150359544 TGTGTGTGGTGTGTGTGTGGTGG - Intergenic
1034428087 7:151025129-151025151 TCACTGTAGTGTGTGTGTGGAGG - Intergenic
1034697448 7:153066448-153066470 GCTGCATGGAGTGTGTGTGAAGG + Intergenic
1034824803 7:154251907-154251929 TGTTTCTGGTGTGTCTGTGAGGG - Intronic
1034841755 7:154404028-154404050 TCTCTGGGGTGTGTTTGTGAAGG - Intronic
1035283188 7:157790117-157790139 TGTGTGTGGTGTGTGTGTGGTGG + Intronic
1035420155 7:158723286-158723308 TGTGTGTGGTGTGTGTGTGATGG + Intergenic
1035545407 8:478474-478496 TCTGGATGGTGTGGGGGTGATGG - Intergenic
1037468796 8:19186816-19186838 TCCCACTGGTGTGTGTGTGATGG + Intergenic
1037748349 8:21663753-21663775 CCTGCAGGGTGTGTGTGTGATGG - Intergenic
1038300177 8:26337323-26337345 TCTTCAGGGTGTCTGTGTGAGGG + Intronic
1039477995 8:37851189-37851211 TCTGAGTGGTGTGTGTGTGCGGG - Intergenic
1039527181 8:38227177-38227199 TGTCTGTGATGTGTCTGTGAGGG - Intronic
1039654937 8:39394034-39394056 TCTTTTTTGTGTGTGTGAGACGG + Intergenic
1040474399 8:47763966-47763988 TGTGTGTGGTGTGTGTGTGATGG + Intergenic
1040474416 8:47764111-47764133 TGTGTGTGTTGTGTGTGTGATGG + Intergenic
1040901120 8:52418198-52418220 TCACTATCGTGTGTGTGTGTGGG - Intronic
1040914375 8:52554218-52554240 GCTTTTTTGTGTGTGTGTGACGG - Intronic
1041068018 8:54101438-54101460 TCTGCCTGGTGTGTGGGTGAGGG - Intronic
1041366875 8:57115653-57115675 TCTCCCTGGTGTGAGTGTGAAGG - Intergenic
1042840473 8:73118385-73118407 TGTGTGTGGTGTGTGTGTGTGGG + Intronic
1043148514 8:76683404-76683426 TTTGTTTGGTGTGTGTGTGGGGG - Intronic
1043540441 8:81256150-81256172 TTTTTTTGGTGTGTGTGTGGGGG + Intergenic
1044181154 8:89196825-89196847 TATTTTTTGTGTGTGTGTGAGGG - Intergenic
1044690465 8:94872236-94872258 TTTTTTTTGTGTGTGTGTGATGG + Intronic
1044734444 8:95265117-95265139 TCTCTGGGGTGTGTATGTGGGGG + Intronic
1045229634 8:100290607-100290629 TATCTATCCTGTGTTTGTGAAGG - Intronic
1046967525 8:120184194-120184216 TGTTTGTGGTGTGTGTGTGGGGG + Intronic
1047198906 8:122747072-122747094 TATCCTTGGTGTGTCTGTGACGG - Intergenic
1048264763 8:132975817-132975839 TCACTATGTTGTGTGATTGAAGG + Intronic
1048293019 8:133194677-133194699 TGTGTGTGGTGTGTGTGTGGAGG + Intronic
1048600430 8:135913873-135913895 ACTTTTTTGTGTGTGTGTGATGG - Intergenic
1048684851 8:136893076-136893098 TCTCTATGGTATGTGAATGAGGG - Intergenic
1048871783 8:138804893-138804915 TGTGTGTGGTGGGTGTGTGATGG + Intronic
1048871828 8:138805305-138805327 GGTGTTTGGTGTGTGTGTGATGG + Intronic
1048957889 8:139551873-139551895 CAGCTATGGTGTGTGTGTGGTGG - Intergenic
1049162683 8:141107502-141107524 GCTCTTTTGGGTGTGTGTGATGG + Intergenic
1049504747 8:142990185-142990207 TCTGTGTGGTGTGGGTGTGTGGG + Intergenic
1051842965 9:21419190-21419212 TCCCTAGAGTGTTTGTGTGAGGG - Intronic
1052647516 9:31254795-31254817 TTCCTTTGGTGTGTGTGTGGAGG - Intergenic
1052662327 9:31449809-31449831 TGCCTGTGGTGTGTGTGTGTGGG - Intergenic
1055342480 9:75299052-75299074 TCTCTTTGGTCTCAGTGTGAAGG - Intergenic
1055893928 9:81153746-81153768 GTTCAATGGTGTGTGTGTGGAGG - Intergenic
1055968509 9:81888584-81888606 TTTTTTTTGTGTGTGTGTGACGG - Intergenic
1056222843 9:84467280-84467302 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
1056558981 9:87713406-87713428 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
1056577879 9:87869790-87869812 TGTGTGTGGTGTGTGTGTGGTGG - Intergenic
1056775413 9:89508736-89508758 TCTCTCAGGTGTGTCTGTGAGGG - Intergenic
1057386614 9:94610674-94610696 ACTTTTTGGTGTGTGTGTGGGGG - Intronic
1059001000 9:110348822-110348844 TTTTTTTGGTGTGTGTGTGGGGG + Intergenic
1059008457 9:110430116-110430138 TTTTTTTGGTGTGTGTGTGTGGG + Intronic
1061453759 9:130682531-130682553 TCTCGCTGGAGTGTGTGTGTTGG - Exonic
1061594554 9:131620518-131620540 TCTCAATTGTGTCTGTGGGACGG + Intronic
1061662967 9:132142584-132142606 TGTGTGTGGTGTGTGTGTGGGGG - Intergenic
1062032626 9:134368631-134368653 GCTGTGTGGTGTGTGTGTGAGGG + Intronic
1203359638 Un_KI270442v1:204520-204542 TCTCTCTGGTTTTTATGTGAAGG + Intergenic
1203408844 Un_KI270538v1:75750-75772 TCTCTCTAGTTTGTATGTGAAGG + Intergenic
1185558151 X:1037396-1037418 TCTCTCAGGTGTGGGAGTGAGGG - Intergenic
1186194405 X:7097034-7097056 TCTTTGGAGTGTGTGTGTGAGGG - Intronic
1186526972 X:10257752-10257774 TTCCTTTGGTGTGTGTGTGGGGG - Intergenic
1187197345 X:17100311-17100333 TCTCCATAGCGTGTGTGTAAAGG + Intronic
1187535298 X:20136247-20136269 TATGTCTGGTGTGTGTGTGGGGG - Intronic
1188378343 X:29460788-29460810 TCTCTTTAGTGTTTTTGTGAAGG - Intronic
1190264381 X:48818643-48818665 TGTCTTGGCTGTGTGTGTGAGGG + Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1190709325 X:53055019-53055041 TGTCTATGGAGTGTGTGTATGGG + Intronic
1192448819 X:71230128-71230150 TCTTTTTTGTGTGTGTGTGGTGG - Intergenic
1192891335 X:75394082-75394104 GATCTTTGGTGTGTCTGTGATGG - Intronic
1193158462 X:78200118-78200140 TCTATAGAGTGTGTGTGTGGGGG - Intergenic
1193158464 X:78200120-78200142 TATCTATAGAGTGTGTGTGTGGG - Intergenic
1193461726 X:81798160-81798182 GCTCCTTGGTGTGTCTGTGAGGG + Intergenic
1193574143 X:83178866-83178888 TCCCTTGGGTGTGTCTGTGAGGG - Intergenic
1193644257 X:84047563-84047585 TGTCCCTGGTGTGTGTGTGAAGG + Intergenic
1195598621 X:106721410-106721432 TCTCTATAGAGTCGGTGTGATGG + Intronic
1195654198 X:107319644-107319666 TGTCTGTAGTGTGTGTGTGGGGG + Intergenic
1195949197 X:110249536-110249558 TCTGTTTTGTGTGTGTGTGCTGG - Intronic
1196339107 X:114575584-114575606 TTTCTTTTGTGTGTGTGTGGGGG - Intergenic
1197533913 X:127663831-127663853 GCTCTTTGGTGTGTGTGTGTTGG - Intergenic
1197802719 X:130368393-130368415 TTTCTTTTGTGTGTGTGTGGGGG - Intronic
1197820682 X:130538067-130538089 AATCTTTGGTGTGTGGGTGAAGG - Intergenic
1197935738 X:131738411-131738433 TCTTTTTTGTGTGTGTGAGATGG - Intergenic
1199424550 X:147685611-147685633 TCTAGTTTGTGTGTGTGTGAAGG - Intergenic
1201566276 Y:15368357-15368379 TCTTTGGAGTGTGTGTGTGAGGG - Intergenic
1201777301 Y:17680138-17680160 TCTTTCTGGAGTATGTGTGAAGG - Intergenic
1201824256 Y:18225854-18225876 TCTTTCTGGAGTATGTGTGAAGG + Intergenic
1202370798 Y:24194246-24194268 TCTCCTGGGTGTGTCTGTGAGGG - Intergenic
1202499986 Y:25475871-25475893 TCTCCTGGGTGTGTCTGTGAGGG + Intergenic