ID: 1089797959

View in Genome Browser
Species Human (GRCh38)
Location 11:120998554-120998576
Sequence CAGGAGAAGAATGCTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089797953_1089797959 11 Left 1089797953 11:120998520-120998542 CCATTCAAATTCCTTATCAGAGG No data
Right 1089797959 11:120998554-120998576 CAGGAGAAGAATGCTGTTGCAGG No data
1089797952_1089797959 12 Left 1089797952 11:120998519-120998541 CCCATTCAAATTCCTTATCAGAG No data
Right 1089797959 11:120998554-120998576 CAGGAGAAGAATGCTGTTGCAGG No data
1089797955_1089797959 0 Left 1089797955 11:120998531-120998553 CCTTATCAGAGGCTGCCTTCTTC No data
Right 1089797959 11:120998554-120998576 CAGGAGAAGAATGCTGTTGCAGG No data
1089797951_1089797959 13 Left 1089797951 11:120998518-120998540 CCCCATTCAAATTCCTTATCAGA No data
Right 1089797959 11:120998554-120998576 CAGGAGAAGAATGCTGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089797959 Original CRISPR CAGGAGAAGAATGCTGTTGC AGG Intergenic
No off target data available for this crispr