ID: 1089799995

View in Genome Browser
Species Human (GRCh38)
Location 11:121019790-121019812
Sequence CTTTGGAAGGTCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089799989_1089799995 -8 Left 1089799989 11:121019775-121019797 CCTGTAATCCCAGCACTTTGGAA 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
Right 1089799995 11:121019790-121019812 CTTTGGAAGGTCAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089799995 Original CRISPR CTTTGGAAGGTCAAGGTGGA AGG Intergenic
No off target data available for this crispr