ID: 1089800569

View in Genome Browser
Species Human (GRCh38)
Location 11:121023996-121024018
Sequence GGGTCCTCCCCAACCGCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089800569_1089800576 11 Left 1089800569 11:121023996-121024018 CCCAGCGCGGTTGGGGAGGACCC 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1089800576 11:121024030-121024052 GCCCCCTCCCATTCACGCAGCGG 0: 1
1: 0
2: 0
3: 4
4: 123
1089800569_1089800584 29 Left 1089800569 11:121023996-121024018 CCCAGCGCGGTTGGGGAGGACCC 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1089800584 11:121024048-121024070 AGCGGACGTGACACGTGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1089800569_1089800585 30 Left 1089800569 11:121023996-121024018 CCCAGCGCGGTTGGGGAGGACCC 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800569_1089800583 26 Left 1089800569 11:121023996-121024018 CCCAGCGCGGTTGGGGAGGACCC 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1089800583 11:121024045-121024067 CGCAGCGGACGTGACACGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089800569 Original CRISPR GGGTCCTCCCCAACCGCGCT GGG (reversed) Intergenic