ID: 1089800570

View in Genome Browser
Species Human (GRCh38)
Location 11:121023997-121024019
Sequence CGGGTCCTCCCCAACCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089800570_1089800583 25 Left 1089800570 11:121023997-121024019 CCAGCGCGGTTGGGGAGGACCCG 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1089800583 11:121024045-121024067 CGCAGCGGACGTGACACGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 20
1089800570_1089800576 10 Left 1089800570 11:121023997-121024019 CCAGCGCGGTTGGGGAGGACCCG 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1089800576 11:121024030-121024052 GCCCCCTCCCATTCACGCAGCGG 0: 1
1: 0
2: 0
3: 4
4: 123
1089800570_1089800584 28 Left 1089800570 11:121023997-121024019 CCAGCGCGGTTGGGGAGGACCCG 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1089800584 11:121024048-121024070 AGCGGACGTGACACGTGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1089800570_1089800585 29 Left 1089800570 11:121023997-121024019 CCAGCGCGGTTGGGGAGGACCCG 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800570_1089800586 30 Left 1089800570 11:121023997-121024019 CCAGCGCGGTTGGGGAGGACCCG 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1089800586 11:121024050-121024072 CGGACGTGACACGTGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089800570 Original CRISPR CGGGTCCTCCCCAACCGCGC TGG (reversed) Intergenic