ID: 1089800572

View in Genome Browser
Species Human (GRCh38)
Location 11:121024016-121024038
Sequence GGAGGGGGCGCCGGAGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1585
Summary {0: 1, 1: 2, 2: 9, 3: 132, 4: 1441}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089800572_1089800586 11 Left 1089800572 11:121024016-121024038 CCCGCTCCTCCGGCGCCCCCTCC 0: 1
1: 2
2: 9
3: 132
4: 1441
Right 1089800586 11:121024050-121024072 CGGACGTGACACGTGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 6
1089800572_1089800583 6 Left 1089800572 11:121024016-121024038 CCCGCTCCTCCGGCGCCCCCTCC 0: 1
1: 2
2: 9
3: 132
4: 1441
Right 1089800583 11:121024045-121024067 CGCAGCGGACGTGACACGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 20
1089800572_1089800587 28 Left 1089800572 11:121024016-121024038 CCCGCTCCTCCGGCGCCCCCTCC 0: 1
1: 2
2: 9
3: 132
4: 1441
Right 1089800587 11:121024067-121024089 GCGGGGTCACGTGTTGTTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 39
1089800572_1089800588 29 Left 1089800572 11:121024016-121024038 CCCGCTCCTCCGGCGCCCCCTCC 0: 1
1: 2
2: 9
3: 132
4: 1441
Right 1089800588 11:121024068-121024090 CGGGGTCACGTGTTGTTGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 38
1089800572_1089800584 9 Left 1089800572 11:121024016-121024038 CCCGCTCCTCCGGCGCCCCCTCC 0: 1
1: 2
2: 9
3: 132
4: 1441
Right 1089800584 11:121024048-121024070 AGCGGACGTGACACGTGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1089800572_1089800585 10 Left 1089800572 11:121024016-121024038 CCCGCTCCTCCGGCGCCCCCTCC 0: 1
1: 2
2: 9
3: 132
4: 1441
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800572_1089800576 -9 Left 1089800572 11:121024016-121024038 CCCGCTCCTCCGGCGCCCCCTCC 0: 1
1: 2
2: 9
3: 132
4: 1441
Right 1089800576 11:121024030-121024052 GCCCCCTCCCATTCACGCAGCGG 0: 1
1: 0
2: 0
3: 4
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089800572 Original CRISPR GGAGGGGGCGCCGGAGGAGC GGG (reversed) Intergenic