ID: 1089800575

View in Genome Browser
Species Human (GRCh38)
Location 11:121024025-121024047
Sequence GCGTGAATGGGAGGGGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 220}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089800575_1089800583 -3 Left 1089800575 11:121024025-121024047 CCGGCGCCCCCTCCCATTCACGC 0: 1
1: 0
2: 1
3: 31
4: 220
Right 1089800583 11:121024045-121024067 CGCAGCGGACGTGACACGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 20
1089800575_1089800590 25 Left 1089800575 11:121024025-121024047 CCGGCGCCCCCTCCCATTCACGC 0: 1
1: 0
2: 1
3: 31
4: 220
Right 1089800590 11:121024073-121024095 TCACGTGTTGTTGTTGGGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 65
1089800575_1089800587 19 Left 1089800575 11:121024025-121024047 CCGGCGCCCCCTCCCATTCACGC 0: 1
1: 0
2: 1
3: 31
4: 220
Right 1089800587 11:121024067-121024089 GCGGGGTCACGTGTTGTTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 39
1089800575_1089800584 0 Left 1089800575 11:121024025-121024047 CCGGCGCCCCCTCCCATTCACGC 0: 1
1: 0
2: 1
3: 31
4: 220
Right 1089800584 11:121024048-121024070 AGCGGACGTGACACGTGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1089800575_1089800585 1 Left 1089800575 11:121024025-121024047 CCGGCGCCCCCTCCCATTCACGC 0: 1
1: 0
2: 1
3: 31
4: 220
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800575_1089800586 2 Left 1089800575 11:121024025-121024047 CCGGCGCCCCCTCCCATTCACGC 0: 1
1: 0
2: 1
3: 31
4: 220
Right 1089800586 11:121024050-121024072 CGGACGTGACACGTGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 6
1089800575_1089800588 20 Left 1089800575 11:121024025-121024047 CCGGCGCCCCCTCCCATTCACGC 0: 1
1: 0
2: 1
3: 31
4: 220
Right 1089800588 11:121024068-121024090 CGGGGTCACGTGTTGTTGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 38
1089800575_1089800589 24 Left 1089800575 11:121024025-121024047 CCGGCGCCCCCTCCCATTCACGC 0: 1
1: 0
2: 1
3: 31
4: 220
Right 1089800589 11:121024072-121024094 GTCACGTGTTGTTGTTGGGCCGG 0: 1
1: 0
2: 1
3: 6
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089800575 Original CRISPR GCGTGAATGGGAGGGGGCGC CGG (reversed) Intergenic