ID: 1089800578

View in Genome Browser
Species Human (GRCh38)
Location 11:121024032-121024054
Sequence GTCCGCTGCGTGAATGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 49}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089800578_1089800584 -7 Left 1089800578 11:121024032-121024054 CCCCTCCCATTCACGCAGCGGAC 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1089800584 11:121024048-121024070 AGCGGACGTGACACGTGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1089800578_1089800587 12 Left 1089800578 11:121024032-121024054 CCCCTCCCATTCACGCAGCGGAC 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1089800587 11:121024067-121024089 GCGGGGTCACGTGTTGTTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 39
1089800578_1089800585 -6 Left 1089800578 11:121024032-121024054 CCCCTCCCATTCACGCAGCGGAC 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800578_1089800583 -10 Left 1089800578 11:121024032-121024054 CCCCTCCCATTCACGCAGCGGAC 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1089800583 11:121024045-121024067 CGCAGCGGACGTGACACGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 20
1089800578_1089800586 -5 Left 1089800578 11:121024032-121024054 CCCCTCCCATTCACGCAGCGGAC 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1089800586 11:121024050-121024072 CGGACGTGACACGTGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 6
1089800578_1089800589 17 Left 1089800578 11:121024032-121024054 CCCCTCCCATTCACGCAGCGGAC 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1089800589 11:121024072-121024094 GTCACGTGTTGTTGTTGGGCCGG 0: 1
1: 0
2: 1
3: 6
4: 34
1089800578_1089800588 13 Left 1089800578 11:121024032-121024054 CCCCTCCCATTCACGCAGCGGAC 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1089800588 11:121024068-121024090 CGGGGTCACGTGTTGTTGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 38
1089800578_1089800590 18 Left 1089800578 11:121024032-121024054 CCCCTCCCATTCACGCAGCGGAC 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1089800590 11:121024073-121024095 TCACGTGTTGTTGTTGGGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089800578 Original CRISPR GTCCGCTGCGTGAATGGGAG GGG (reversed) Intergenic