ID: 1089800579

View in Genome Browser
Species Human (GRCh38)
Location 11:121024033-121024055
Sequence CGTCCGCTGCGTGAATGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089800579_1089800587 11 Left 1089800579 11:121024033-121024055 CCCTCCCATTCACGCAGCGGACG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1089800587 11:121024067-121024089 GCGGGGTCACGTGTTGTTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 39
1089800579_1089800585 -7 Left 1089800579 11:121024033-121024055 CCCTCCCATTCACGCAGCGGACG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800579_1089800590 17 Left 1089800579 11:121024033-121024055 CCCTCCCATTCACGCAGCGGACG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1089800590 11:121024073-121024095 TCACGTGTTGTTGTTGGGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 65
1089800579_1089800588 12 Left 1089800579 11:121024033-121024055 CCCTCCCATTCACGCAGCGGACG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1089800588 11:121024068-121024090 CGGGGTCACGTGTTGTTGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 38
1089800579_1089800584 -8 Left 1089800579 11:121024033-121024055 CCCTCCCATTCACGCAGCGGACG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1089800584 11:121024048-121024070 AGCGGACGTGACACGTGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1089800579_1089800589 16 Left 1089800579 11:121024033-121024055 CCCTCCCATTCACGCAGCGGACG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1089800589 11:121024072-121024094 GTCACGTGTTGTTGTTGGGCCGG 0: 1
1: 0
2: 1
3: 6
4: 34
1089800579_1089800586 -6 Left 1089800579 11:121024033-121024055 CCCTCCCATTCACGCAGCGGACG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1089800586 11:121024050-121024072 CGGACGTGACACGTGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089800579 Original CRISPR CGTCCGCTGCGTGAATGGGA GGG (reversed) Intergenic