ID: 1089800585

View in Genome Browser
Species Human (GRCh38)
Location 11:121024049-121024071
Sequence GCGGACGTGACACGTGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089800578_1089800585 -6 Left 1089800578 11:121024032-121024054 CCCCTCCCATTCACGCAGCGGAC 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800577_1089800585 -5 Left 1089800577 11:121024031-121024053 CCCCCTCCCATTCACGCAGCGGA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800569_1089800585 30 Left 1089800569 11:121023996-121024018 CCCAGCGCGGTTGGGGAGGACCC 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800573_1089800585 9 Left 1089800573 11:121024017-121024039 CCGCTCCTCCGGCGCCCCCTCCC 0: 1
1: 1
2: 19
3: 177
4: 1590
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800570_1089800585 29 Left 1089800570 11:121023997-121024019 CCAGCGCGGTTGGGGAGGACCCG 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800572_1089800585 10 Left 1089800572 11:121024016-121024038 CCCGCTCCTCCGGCGCCCCCTCC 0: 1
1: 2
2: 9
3: 132
4: 1441
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800575_1089800585 1 Left 1089800575 11:121024025-121024047 CCGGCGCCCCCTCCCATTCACGC 0: 1
1: 0
2: 1
3: 31
4: 220
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800579_1089800585 -7 Left 1089800579 11:121024033-121024055 CCCTCCCATTCACGCAGCGGACG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800574_1089800585 4 Left 1089800574 11:121024022-121024044 CCTCCGGCGCCCCCTCCCATTCA 0: 1
1: 0
2: 0
3: 20
4: 204
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800580_1089800585 -8 Left 1089800580 11:121024034-121024056 CCTCCCATTCACGCAGCGGACGT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089800585 Original CRISPR GCGGACGTGACACGTGCGGC GGG Intergenic
900507609 1:3037471-3037493 GCTGAGGTGACACGTGCGCAAGG + Intergenic
900593336 1:3469334-3469356 GAGGACGTGACCCGGGTGGCAGG - Intronic
915205717 1:154269107-154269129 GCGCACATAACACGAGCGGCCGG + Intronic
1063417966 10:5889389-5889411 GCGGGCGGGACACCGGCGGCCGG + Exonic
1087761710 11:102110234-102110256 GCGAGCGGGTCACGTGCGGCCGG + Intergenic
1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG + Intergenic
1094199187 12:27779986-27780008 GCGGAAGTGAGAAGGGCGGCGGG + Intergenic
1095584614 12:43836270-43836292 GCAGCCGGGACACGGGCGGCAGG - Intronic
1124844697 15:33279114-33279136 GCTGACGGGACAGGTGAGGCTGG + Intergenic
1125728879 15:41882022-41882044 GCTGAGGCGCCACGTGCGGCTGG - Exonic
1131215200 15:90530244-90530266 GCGGGCGGGACCCGCGCGGCGGG + Intronic
1131692844 15:94845182-94845204 GCGGCAGCGACACGCGCGGCCGG + Intergenic
1132580886 16:684188-684210 GCGGTGGGGTCACGTGCGGCGGG - Intronic
1134523420 16:14928555-14928577 GCGGACGGGCCACGTGGGGCGGG - Intronic
1134711014 16:16327039-16327061 GCGGACGGGCCACGTGGGGCGGG - Intergenic
1134948569 16:18341570-18341592 GCGGACGGGCCACGTGGGGCGGG + Intergenic
1138590652 16:57997992-57998014 GCGGACTGGACAGGTGCGCCAGG + Exonic
1149997096 17:61411182-61411204 TCGGAGGGGACATGTGCGGCGGG - Intergenic
1162778563 19:12995204-12995226 CTGGACGTGACATGTGTGGCGGG + Intergenic
925445932 2:3927028-3927050 GCTGAGGTGACATGTGGGGCTGG + Intergenic
927649221 2:24901219-24901241 ACTGACGTTACACGTGCCGCAGG + Intronic
938320075 2:130356489-130356511 GCGGGCGGGACAGGTGGGGCGGG + Intronic
1169161228 20:3380155-3380177 GCTGAGGTGAAACGTGTGGCTGG + Intronic
1176548616 21:8212293-8212315 GCGCACGCCACACGCGCGGCAGG - Intergenic
1176556510 21:8256501-8256523 GCGCACGCCACACGCGCGGCAGG - Intergenic
1176567547 21:8395328-8395350 GCGCACGCCACACGCGCGGCAGG - Intergenic
1176575449 21:8439543-8439565 GCGCACGCCACACGCGCGGCAGG - Intergenic
1180606583 22:17063479-17063501 GCGGAACTGTCACGTGCTGCTGG + Intergenic
1203253499 22_KI270733v1_random:128598-128620 GCGCACGCCACACGCGCGGCAGG - Intergenic
1203261554 22_KI270733v1_random:173676-173698 GCGCACGCCACACGCGCGGCAGG - Intergenic
951558810 3:23945843-23945865 GCGCACGTGGCTCGCGCGGCCGG - Intronic
977257687 4:94758397-94758419 GCGGGCGGGACACGTGCTTCGGG + Intronic
985640418 5:1061064-1061086 GCGGATGCGGCAGGTGCGGCGGG - Intronic
985640541 5:1061514-1061536 GCGGATGCGGCAGGTGCGGCGGG - Intronic
990149425 5:52800043-52800065 GGGGACGGGAGACGTGCGTCGGG + Exonic
1015905822 6:138115432-138115454 GCAGAAGTGACAGGTGCAGCTGG - Intergenic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1029656775 7:101930866-101930888 GCGGACGGGTCACTTGAGGCTGG + Intronic
1034952275 7:155306911-155306933 GCGGACCTGACACGTGGCACAGG - Intronic
1047292362 8:123541425-123541447 GCGGAGGTGCCAGGGGCGGCGGG - Intergenic
1052806725 9:33019997-33020019 TAGGACCTGACACGTGCGGTGGG + Intronic
1203469900 Un_GL000220v1:111745-111767 GCGCACGCCACACGCGCGGCAGG - Intergenic
1203477721 Un_GL000220v1:155717-155739 GCGCACGCCACACGCGCGGCAGG - Intergenic
1200021976 X:153219390-153219412 GAGGATGTGACAAGTGCAGCTGG + Intergenic