ID: 1089800585

View in Genome Browser
Species Human (GRCh38)
Location 11:121024049-121024071
Sequence GCGGACGTGACACGTGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089800569_1089800585 30 Left 1089800569 11:121023996-121024018 CCCAGCGCGGTTGGGGAGGACCC 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800579_1089800585 -7 Left 1089800579 11:121024033-121024055 CCCTCCCATTCACGCAGCGGACG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800575_1089800585 1 Left 1089800575 11:121024025-121024047 CCGGCGCCCCCTCCCATTCACGC 0: 1
1: 0
2: 1
3: 31
4: 220
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800574_1089800585 4 Left 1089800574 11:121024022-121024044 CCTCCGGCGCCCCCTCCCATTCA 0: 1
1: 0
2: 0
3: 20
4: 204
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800572_1089800585 10 Left 1089800572 11:121024016-121024038 CCCGCTCCTCCGGCGCCCCCTCC 0: 1
1: 2
2: 9
3: 132
4: 1441
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800578_1089800585 -6 Left 1089800578 11:121024032-121024054 CCCCTCCCATTCACGCAGCGGAC 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800580_1089800585 -8 Left 1089800580 11:121024034-121024056 CCTCCCATTCACGCAGCGGACGT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800577_1089800585 -5 Left 1089800577 11:121024031-121024053 CCCCCTCCCATTCACGCAGCGGA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800570_1089800585 29 Left 1089800570 11:121023997-121024019 CCAGCGCGGTTGGGGAGGACCCG 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1089800573_1089800585 9 Left 1089800573 11:121024017-121024039 CCGCTCCTCCGGCGCCCCCTCCC 0: 1
1: 1
2: 19
3: 177
4: 1590
Right 1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089800585 Original CRISPR GCGGACGTGACACGTGCGGC GGG Intergenic