ID: 1089800695

View in Genome Browser
Species Human (GRCh38)
Location 11:121024428-121024450
Sequence TCCCCACAGCTGCTCGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089800695_1089800701 3 Left 1089800695 11:121024428-121024450 CCTGTCTCGAGCAGCTGTGGGGA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1089800701 11:121024454-121024476 GAGACCTGCCCTGGGGCTAGAGG 0: 1
1: 0
2: 1
3: 18
4: 282
1089800695_1089800706 11 Left 1089800695 11:121024428-121024450 CCTGTCTCGAGCAGCTGTGGGGA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1089800706 11:121024462-121024484 CCCTGGGGCTAGAGGGAGGATGG 0: 1
1: 0
2: 17
3: 96
4: 724
1089800695_1089800710 22 Left 1089800695 11:121024428-121024450 CCTGTCTCGAGCAGCTGTGGGGA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1089800710 11:121024473-121024495 GAGGGAGGATGGGGCCTGCCTGG 0: 1
1: 0
2: 5
3: 67
4: 701
1089800695_1089800708 12 Left 1089800695 11:121024428-121024450 CCTGTCTCGAGCAGCTGTGGGGA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1089800708 11:121024463-121024485 CCTGGGGCTAGAGGGAGGATGGG 0: 1
1: 0
2: 5
3: 63
4: 487
1089800695_1089800704 7 Left 1089800695 11:121024428-121024450 CCTGTCTCGAGCAGCTGTGGGGA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1089800704 11:121024458-121024480 CCTGCCCTGGGGCTAGAGGGAGG 0: 1
1: 1
2: 5
3: 59
4: 444
1089800695_1089800711 27 Left 1089800695 11:121024428-121024450 CCTGTCTCGAGCAGCTGTGGGGA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1089800711 11:121024478-121024500 AGGATGGGGCCTGCCTGGCCTGG 0: 1
1: 0
2: 4
3: 61
4: 469
1089800695_1089800702 4 Left 1089800695 11:121024428-121024450 CCTGTCTCGAGCAGCTGTGGGGA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1089800702 11:121024455-121024477 AGACCTGCCCTGGGGCTAGAGGG 0: 1
1: 0
2: 2
3: 20
4: 228
1089800695_1089800712 28 Left 1089800695 11:121024428-121024450 CCTGTCTCGAGCAGCTGTGGGGA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1089800712 11:121024479-121024501 GGATGGGGCCTGCCTGGCCTGGG 0: 1
1: 1
2: 4
3: 55
4: 488
1089800695_1089800698 -6 Left 1089800695 11:121024428-121024450 CCTGTCTCGAGCAGCTGTGGGGA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1089800698 11:121024445-121024467 TGGGGATGGGAGACCTGCCCTGG 0: 1
1: 0
2: 5
3: 35
4: 344
1089800695_1089800699 -5 Left 1089800695 11:121024428-121024450 CCTGTCTCGAGCAGCTGTGGGGA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1089800699 11:121024446-121024468 GGGGATGGGAGACCTGCCCTGGG 0: 1
1: 2
2: 4
3: 40
4: 373
1089800695_1089800709 13 Left 1089800695 11:121024428-121024450 CCTGTCTCGAGCAGCTGTGGGGA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1089800709 11:121024464-121024486 CTGGGGCTAGAGGGAGGATGGGG 0: 1
1: 1
2: 9
3: 89
4: 674
1089800695_1089800700 -4 Left 1089800695 11:121024428-121024450 CCTGTCTCGAGCAGCTGTGGGGA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1089800700 11:121024447-121024469 GGGATGGGAGACCTGCCCTGGGG 0: 1
1: 0
2: 1
3: 30
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089800695 Original CRISPR TCCCCACAGCTGCTCGAGAC AGG (reversed) Intronic
902214043 1:14923761-14923783 TCCCCACAGCTGACCGGGAGAGG - Intronic
902797441 1:18808672-18808694 TGCCCACAGCTGGTAGAAACAGG + Intergenic
903211779 1:21822897-21822919 GCCCCACAGCTACCTGAGACGGG - Exonic
904527180 1:31142534-31142556 TCCCCACAGTTCCTCTAGATAGG - Intergenic
904846484 1:33422323-33422345 TCCCCCCAGCTGCTAGAGTGAGG + Intronic
907487722 1:54788818-54788840 TCACCCCAGCTGCTGGGGACGGG - Intronic
915513715 1:156400888-156400910 TCCCCACAGCTTCTCCACAAAGG + Intergenic
916732501 1:167579296-167579318 TCCCCACAGCTTTCCGAGGCAGG + Intergenic
922113212 1:222583230-222583252 TCCTCACAGCTGCCGGACACTGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924496783 1:244598114-244598136 TCCCCAAACCTACTGGAGACTGG - Intronic
1072429942 10:95361931-95361953 TCCCCTCAGCTGGTTGAGAAAGG + Intronic
1073906923 10:108292709-108292731 TCCCCAAAACTGCCCAAGACAGG + Intergenic
1074301959 10:112240981-112241003 TCATAACAGCTGCTCCAGACTGG + Intergenic
1075297857 10:121293788-121293810 TCCCCACTGCTGCAGAAGACAGG - Intergenic
1077115513 11:882900-882922 TCCCCACATCTGCGTGAGGCTGG - Intronic
1077116861 11:889117-889139 ACCCCACAGCTGCCAGAGGCCGG + Intronic
1084673134 11:70619339-70619361 TCCCCAGAGCTGGAAGAGACAGG - Intronic
1085386314 11:76160244-76160266 TAGCCTCAGCTGCTCCAGACCGG - Intergenic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1089856199 11:121547183-121547205 TCCCCAGACCAGCTTGAGACTGG + Intronic
1091345168 11:134847512-134847534 TCTCCACTGCCGCTGGAGACAGG + Intergenic
1096498089 12:52050285-52050307 TCCCCACAGGTGCTGGAGGTAGG + Intronic
1099619074 12:84977180-84977202 TCCCCACATCTGCAGGATACCGG - Intergenic
1100177704 12:92049916-92049938 TCCCCACAGCAGGTAAAGACAGG + Intronic
1106702362 13:32244033-32244055 CCCCCACAGCTGCTGGAGAAGGG + Exonic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1107561445 13:41560677-41560699 TCCTCACAGCTCCTTCAGACAGG - Intergenic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1113156795 13:107332524-107332546 GCCCCACAGCTGCTCCTGAGGGG - Intronic
1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG + Intronic
1114344394 14:21780554-21780576 CCGCAACAGCTGCTCCAGACAGG - Intergenic
1114660204 14:24338955-24338977 GCCCCAGAGCTGCTCCAGCCAGG - Intronic
1117043764 14:51791815-51791837 TCCCCACAGCTTCTCAAGGTTGG - Intergenic
1119703944 14:76772647-76772669 TCCCCGCAGCTGCCTGAGCCTGG - Intronic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1122296068 14:100706358-100706380 GGCCCACAGCTGCTCTAGCCTGG - Intergenic
1122386045 14:101349014-101349036 TCCCAACGTCTGCTCGAGTCTGG + Intergenic
1122551140 14:102550657-102550679 TCCACACAGCTGCTGGGGCCTGG - Intergenic
1124364574 15:29062884-29062906 TCCCCACAGCCCCACGAGATGGG - Intronic
1129159171 15:73737693-73737715 CCCCTGCAGCTGCTCCAGACCGG + Exonic
1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG + Intronic
1132725336 16:1335951-1335973 TCCCCAGAGCGGCCCGAGAGGGG - Intronic
1134218782 16:12337227-12337249 TCTCCACAGTTGCTGGAGATAGG + Intronic
1136027940 16:27481941-27481963 TCCCCACAGCAAATTGAGACTGG - Intronic
1136418327 16:30116866-30116888 GCCCCACTGCTGCTGGGGACTGG + Intronic
1138925232 16:61581957-61581979 CCACAACAGCTGCTCCAGACAGG + Intergenic
1141885457 16:86888822-86888844 TCCCTAAAGATGCTCAAGACAGG - Intergenic
1144501233 17:15787635-15787657 TCCCCACTGATGCTGGAGCCCGG - Intergenic
1145119723 17:20247052-20247074 TCCCCAAAGCAGCTCTAGTCCGG + Intronic
1145163401 17:20590309-20590331 TCCCCACTGATGCTGGAGGCCGG - Intergenic
1146907137 17:36624997-36625019 ACCCCAAAGCTGCTTGAGTCAGG + Intergenic
1147003441 17:37382261-37382283 CCCCCACAGCTGCTGGACAGTGG + Intronic
1147602934 17:41757067-41757089 TCCCCTGAGCTGCTCTAGTCCGG - Intronic
1151804450 17:76396904-76396926 TCCGCACAGCTGATGGCGACTGG + Intronic
1153514130 18:5889777-5889799 TGCCCACAGCTGCTTGCGAATGG - Exonic
1155163032 18:23210905-23210927 TCCCTCCAGCCGCTTGAGACTGG + Intronic
1160113599 18:76056852-76056874 TCCCCACAGCTGCTAGAAGGAGG + Intergenic
1161315657 19:3616113-3616135 TCCCAGCAGCTGCTAGAGGCTGG + Intronic
1164750345 19:30649097-30649119 GCCCGACAGCTGCCCCAGACAGG + Intronic
1165122601 19:33570242-33570264 TCCCCACAGCTGTTTGCCACGGG - Intergenic
1166512292 19:43417112-43417134 TTCCCACTGCTGCACGAGAACGG + Intronic
925718264 2:6804631-6804653 TCTCCACTGCTCCTCAAGACCGG + Intergenic
925901299 2:8511155-8511177 TCCCCACAGCTGCAGGGGGCAGG - Intergenic
929489600 2:42384486-42384508 CCCACACAGCTGCTCCAGTCTGG - Intronic
929847284 2:45542532-45542554 TCCCAGCAGCTGCTCCAGATGGG + Intronic
932083056 2:68732676-68732698 TCCCCACTGCTGCTGAGGACTGG + Intronic
933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG + Intronic
934845016 2:97656947-97656969 TCCCCACAGCGGCTCCATCCTGG - Exonic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
934979444 2:98827837-98827859 TCCCCTCAGCTTCCAGAGACAGG - Intronic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
941998746 2:171626286-171626308 TCACAGCAGCTGCTCCAGACAGG - Intergenic
948135698 2:235634441-235634463 CTCCCACAGCTGCTTGTGACAGG - Intronic
948284448 2:236772977-236772999 CCCCCACAGCTGGAAGAGACAGG - Intergenic
948517192 2:238511326-238511348 TCACCACTGCTGCTGGACACCGG - Intergenic
1169207603 20:3749037-3749059 TCCCCACAGCTGTTGGATACAGG + Intronic
1169941804 20:10945775-10945797 TCCTCACAGCTGCAAGAGATAGG + Intergenic
1173061552 20:39666613-39666635 TCTCAACAGCTGTTTGAGACAGG + Intergenic
1173170039 20:40716453-40716475 TCCCCAGAGCAGTTTGAGACAGG + Intergenic
1173577222 20:44120294-44120316 GCCCCACAGTTGCACGTGACAGG + Intronic
1174443933 20:50577785-50577807 TCCCACCAGCTGCTCCAGGCAGG - Intronic
1178429528 21:32506800-32506822 TCCTCACTGCTGCTGGAGAGAGG + Intronic
1179247144 21:39643814-39643836 TTCCCGCAGCTCCTCGAGGCTGG + Intronic
1180032915 21:45224490-45224512 TCCCCACAGCTGCCCCACCCAGG - Exonic
1182230778 22:28836001-28836023 TTCCTCCAGCTGCTCCAGACGGG + Intergenic
1183194007 22:36340789-36340811 TCCCCACCCCTTCTCCAGACTGG - Intronic
1183750508 22:39717615-39717637 TCGCCTCGGCAGCTCGAGACTGG - Intergenic
1184267497 22:43357005-43357027 TCCCCACAGCTGCGCATGCCGGG + Intergenic
1184534746 22:45078547-45078569 TCCCAGGAGCTGCTAGAGACTGG + Intergenic
954601697 3:51875398-51875420 TCCCCACAGTTACTCATGACAGG - Intronic
957046711 3:75381263-75381285 TCCTCAATGCTGCTGGAGACAGG - Intergenic
957939885 3:86991104-86991126 TCCCCACGGCTGCCCGACCCGGG - Exonic
962606284 3:137035360-137035382 TGCCCTCAGCTGCTAGAGCCTGG - Intergenic
967938013 3:194744750-194744772 TCCCCAGAGCTCCTAGGGACTGG + Intergenic
968460834 4:723977-723999 TCCTCACAGCTGCTGGGGAAGGG - Intronic
968567831 4:1323823-1323845 TCCCCACAGCAGCTTCAGACAGG - Intronic
974904946 4:68044120-68044142 TGCCCTCAGCTTCTGGAGACTGG + Intergenic
981936220 4:150242686-150242708 TCCCCAAAGCAGCCAGAGACAGG + Intronic
982694065 4:158579966-158579988 TTCCCACAGGTTCTAGAGACAGG + Intronic
983482254 4:168289723-168289745 TCCCCACAAATGCTCAAGCCAGG + Intronic
985104255 4:186485688-186485710 TGCCCACAGCTTCTGGAGCCTGG + Intronic
998515503 5:142750111-142750133 TCCTCACAGCTGATGAAGACAGG + Intergenic
998843027 5:146276541-146276563 TCCCCACAGCCTCTCAAGACAGG + Intronic
1001140078 5:169137098-169137120 TCCCGACAGCTTCTCATGACAGG + Intronic
1001641431 5:173246651-173246673 TCCCTACAGCTTCTCAAGAGAGG - Intergenic
1001984282 5:176060894-176060916 CCCCCACCGCTGCTCGTGCCAGG - Intronic
1002233194 5:177783171-177783193 CCCCCACCGCTGCTCGTGCCAGG + Intronic
1002262785 5:178006610-178006632 CCCCCACCGCTGCTCGTGCCAGG - Intronic
1002720829 5:181260704-181260726 TGCCCACAGCTGATGGACACGGG + Exonic
1004302889 6:14474702-14474724 TCCCCACATCTGCTCCACCCAGG + Intergenic
1004355032 6:14923336-14923358 TCCCCAGACCTGCTCGAGGGGGG + Intergenic
1004493001 6:16135003-16135025 TCCCTACAGCTGCTCAACACTGG - Intronic
1004584644 6:16987793-16987815 TCCCCACAGAGCCTCTAGACGGG - Intergenic
1005099411 6:22153951-22153973 GCCCCACAGCTGGTGGATACAGG - Intergenic
1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG + Intronic
1006670266 6:35725993-35726015 TCCTCTCAGCAGCTCCAGACTGG + Intronic
1013823036 6:114178514-114178536 TTCCCAGAGCTGCCCTAGACAGG + Intronic
1019262794 7:91560-91582 GCACCACATCTGCACGAGACAGG - Intergenic
1022539559 7:31123364-31123386 TCCCCAAAGCTGCTAGTGCCAGG + Intergenic
1024702569 7:51920619-51920641 TACCCACAGCTGATGGGGACTGG - Intergenic
1024969391 7:55054555-55054577 TCTCAACAGTTGCTCCAGACAGG + Intronic
1031858973 7:126957320-126957342 CTGCCACAGCTGCTCCAGACAGG - Intronic
1031935483 7:127731474-127731496 TCCTCACAGCTGCTTGAGCCAGG + Intronic
1031970475 7:128061433-128061455 ACCCCACAGCTTCTCCACACAGG - Intronic
1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG + Intronic
1037654051 8:20867797-20867819 TCCCCCCAGTTGCTCTAGATGGG + Intergenic
1037880857 8:22572757-22572779 CCCCCAGGGCTGCTCGAGGCAGG - Intronic
1037912132 8:22749745-22749767 TCCACACTGCTGCCCGTGACTGG - Intronic
1038697999 8:29823350-29823372 TCCCTACAGCTGGTTGAGATGGG - Intergenic
1039790818 8:40874270-40874292 TCTCCACAGCTGGACGTGACGGG - Intronic
1040952125 8:52947936-52947958 TCCCCATCTCTGCTGGAGACTGG - Intergenic
1042012284 8:64260569-64260591 TCCCCACATCTTCAGGAGACTGG - Intergenic
1046239254 8:111470419-111470441 TCCCAACCGCGGCTCCAGACGGG - Intergenic
1049114749 8:140676425-140676447 TCCCCACTGCTGCAAAAGACAGG - Intronic
1049438609 8:142599043-142599065 TCCCCACAGATGCTGGATGCAGG - Intergenic
1049553421 8:143270993-143271015 TGCCCACAGCTGGTGGAGACAGG - Intronic
1049636874 8:143693812-143693834 TTCCCAGAGCTGCTCCAGAAAGG + Exonic
1054954494 9:70893183-70893205 TCCCCACAGGTCCTCCAGATTGG + Intronic
1057731209 9:97610225-97610247 ACCCCACAGCTGCTTTAGAGAGG + Intronic
1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG + Intergenic
1062183689 9:135204979-135205001 TCCTCACAGCGGCTGGGGACTGG + Intergenic
1186301705 X:8206048-8206070 ACCCCACAGCTGGTGGATACAGG + Intergenic
1196692622 X:118576559-118576581 TCCCCACAGCCCTTGGAGACAGG - Intronic