ID: 1089803732

View in Genome Browser
Species Human (GRCh38)
Location 11:121063460-121063482
Sequence CCCAGTCTTGGATGTTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089803726_1089803732 22 Left 1089803726 11:121063415-121063437 CCTTAAATGACATAACCTAAATC 0: 1
1: 0
2: 1
3: 14
4: 175
Right 1089803732 11:121063460-121063482 CCCAGTCTTGGATGTTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 121
1089803727_1089803732 7 Left 1089803727 11:121063430-121063452 CCTAAATCTTATGAATTGCTGCA 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1089803732 11:121063460-121063482 CCCAGTCTTGGATGTTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089803732 Original CRISPR CCCAGTCTTGGATGTTTGGG TGG Intronic
900906464 1:5563019-5563041 CACAGTCCTGGAGGTGTGGGAGG - Intergenic
902833753 1:19034095-19034117 CCCCGCCCTGCATGTTTGGGAGG - Intergenic
907711782 1:56889861-56889883 GGAAGTCTTGGATGTTAGGGAGG + Intronic
908408321 1:63836979-63837001 CCCTGTCTTGGATGAATGGCAGG + Intronic
909771362 1:79426115-79426137 GCAAGTCTTTGATGTTTGAGAGG + Intergenic
910137991 1:83995308-83995330 CCCAGTGTTGGAGGTGGGGGTGG + Intronic
913413591 1:118579864-118579886 CCCAGTATTGGTTCTTTTGGAGG + Intergenic
914414685 1:147468995-147469017 CACTGTCTTTGCTGTTTGGGTGG - Intergenic
917478189 1:175386720-175386742 GGAAGTCTTGGATGTTTAGGTGG - Intronic
917577769 1:176342054-176342076 CCCAGTTTTGGATGAGTTGGGGG + Intergenic
917977531 1:180250045-180250067 GCAAGTCCTTGATGTTTGGGTGG + Intronic
919516827 1:198535240-198535262 CCCTGTCTTGCATGTTTTGTAGG - Intronic
922928513 1:229370899-229370921 CCCAGAACTGGATGTTTAGGGGG - Intergenic
923619814 1:235569334-235569356 CCTAGTCTTAGCTATTTGGGAGG + Intronic
923789123 1:237096111-237096133 CACAGTCCTGGATTTCTGGGTGG + Intronic
924318664 1:242825104-242825126 CCCATTCATGGATGTGGGGGAGG - Intergenic
1067156552 10:43785889-43785911 CCCAATTTTGGGTGTTTGGATGG + Intergenic
1069885516 10:71620965-71620987 ACCAGTCTTGGATATAGGGGAGG + Intronic
1070138329 10:73715566-73715588 CCCCGTCTGGGATGTGGGGGGGG - Intergenic
1072741784 10:97914205-97914227 CCCAGGACTGGAGGTTTGGGGGG + Intronic
1073137086 10:101226087-101226109 CCTAGCCTTGGAGATTTGGGGGG - Intergenic
1075435542 10:122438006-122438028 CCCAGTTTTGGAGGTCTAGGTGG + Exonic
1075674493 10:124286973-124286995 CCCAGCCTTGGAAGTTTTGCTGG - Intergenic
1077557276 11:3231721-3231743 CTCAGTATTGGCTGTCTGGGCGG - Intronic
1080196928 11:29622120-29622142 CCCAGCCTTAGAGGTTTGGCAGG - Intergenic
1080893759 11:36431951-36431973 CTCAGTCTTTGATGTCTGGACGG + Intronic
1083853242 11:65379738-65379760 CCAAGTCTGGGATCCTTGGGGGG - Intronic
1084651597 11:70492548-70492570 CACAGTTTTGGATGTTGGAGTGG - Intronic
1086336257 11:85803683-85803705 CCCAGTATTGCCTCTTTGGGGGG - Intronic
1087867243 11:103245844-103245866 CCCAGTCTTGGATGATTAGAAGG + Intronic
1089322691 11:117637149-117637171 CCCAGTCTTGGGTGTCGGGAAGG - Intronic
1089803732 11:121063460-121063482 CCCAGTCTTGGATGTTTGGGTGG + Intronic
1095764595 12:45880898-45880920 TGCAGTTTTGGCTGTTTGGGGGG + Intronic
1097138555 12:56879583-56879605 CCCCGTCTGGGAGGTTGGGGGGG + Intergenic
1097694472 12:62763197-62763219 CCCACACTGGGCTGTTTGGGTGG + Intronic
1103230719 12:119328243-119328265 GCCAGTGTGGGTTGTTTGGGTGG + Intergenic
1103878695 12:124149363-124149385 CGGAGTTCTGGATGTTTGGGGGG - Intronic
1106356221 13:28986146-28986168 CCCAGGCTTGGGTGGTTGGGAGG + Intronic
1107801149 13:44109081-44109103 CCCAGACTTGGGTGGTTTGGAGG - Intergenic
1111824129 13:93246917-93246939 CCCAATCATGGAGATTTGGGGGG - Intronic
1113548515 13:111173778-111173800 CCTGGTCTTGGAGGGTTGGGAGG + Intronic
1117373132 14:55097003-55097025 CCCAGTCTAGATTGTTTGGGTGG + Intergenic
1118216022 14:63809088-63809110 CTGGGTTTTGGATGTTTGGGTGG + Intergenic
1118394879 14:65327573-65327595 TGCAGTCTTAGCTGTTTGGGAGG - Intergenic
1119711805 14:76827967-76827989 CCCATTCTTAAGTGTTTGGGTGG - Intronic
1122232750 14:100315050-100315072 CTCAGTCTTGGCTGTTGTGGAGG - Intergenic
1126418221 15:48441411-48441433 CCCAGGCTTTGCTGTTTCGGTGG + Intronic
1129687899 15:77696802-77696824 CCCAGTCCTGAGTGTGTGGGTGG - Intronic
1132762292 16:1515526-1515548 TGCAGTCTTGGCTGCTTGGGAGG - Intronic
1136283486 16:29228173-29228195 CCCAGCCTTGGAGGTTTGTGTGG - Intergenic
1138706939 16:58924802-58924824 ACCAGTATTGGCTGTTGGGGAGG - Intergenic
1139586902 16:67909722-67909744 CCCTGTCCTGGATGTTGGGGAGG + Intronic
1139957928 16:70701939-70701961 CCCAGGCCTCGATGTCTGGGAGG - Intronic
1139974303 16:70796705-70796727 CCCCATTTTGGATGGTTGGGAGG - Intronic
1142087910 16:88194123-88194145 CCCAGCCTTGGAGGTTTGTGTGG - Intergenic
1142121088 16:88387079-88387101 CACAGTCTTGGAGGTTGGGGAGG - Intergenic
1143427638 17:6852881-6852903 CCAAGGCTTGGATCTTTGGGGGG + Intergenic
1143894808 17:10127735-10127757 CCCAGTCTTGGGGGTTTAGGGGG - Intronic
1144068006 17:11641616-11641638 CCCAGCCCTGGAAGTTTGGCGGG + Intronic
1144739946 17:17576191-17576213 CACAGTCTGGGAGGTGTGGGAGG + Intronic
1144937646 17:18913100-18913122 ACCAGTCTTGGGTCTTGGGGTGG + Intronic
1147241800 17:39095374-39095396 CCCAGGCTTGGGGGGTTGGGGGG - Intronic
1150255725 17:63742573-63742595 CCCAGTCTTGGAAGTTAGGACGG - Intronic
1154010711 18:10571805-10571827 TCCAGGCTTGGCTGTTTTGGTGG + Intergenic
1154302328 18:13205095-13205117 CCAAGGGTTGGATGTTGGGGAGG - Intergenic
1156096936 18:33544878-33544900 CCCAGTCTTATACGTTTTGGTGG + Intergenic
1157549521 18:48571703-48571725 CCTATTTCTGGATGTTTGGGTGG + Intronic
1158869923 18:61676343-61676365 CCCAGTCTTTGATAATTGGAGGG + Intergenic
1159772972 18:72569827-72569849 CCCAGTGTTGGATGTGTTGGAGG - Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
927926050 2:27014523-27014545 CCCTGTCCTGGATGTGTGGGAGG + Intronic
929800158 2:45092846-45092868 ACCAGTCTAGGCTCTTTGGGAGG - Intergenic
932598488 2:73108697-73108719 CCCTGTCTTGGGAGTTAGGGAGG + Intronic
936013806 2:108942844-108942866 CCCAGTCTTTTAAGTTTGAGCGG + Intronic
936465241 2:112742472-112742494 TCCAGTCTAGGCTGTTTTGGTGG + Exonic
939739090 2:145884154-145884176 CACAGTCTTTGTTCTTTGGGTGG - Intergenic
941308406 2:163898511-163898533 CCAATTCTTGGATTTCTGGGGGG - Intergenic
946558794 2:220889698-220889720 ACCAGTCTTTGTTGGTTGGGGGG - Intergenic
947614373 2:231545705-231545727 CTCAGTCTTGGTGGTTTGTGTGG - Intergenic
1171982552 20:31638060-31638082 CCCTGTCTTAGAGGGTTGGGGGG + Intronic
1173342876 20:42169177-42169199 CCCAGTGATGGAGGTTTAGGAGG - Intronic
1173618115 20:44416036-44416058 CCCAGCCAGGGAGGTTTGGGTGG - Intronic
1174533048 20:51229964-51229986 CCAAGGCTTGGAGGTCTGGGAGG - Intergenic
1175166315 20:57047165-57047187 ACGAGTCTTGGATGTGCGGGTGG + Intergenic
1175431489 20:58907517-58907539 CCCAGTTTTGAATGCTGGGGGGG + Intronic
1181046728 22:20218216-20218238 CCCAGTGTTGCATGTCTGGTGGG - Intergenic
1181981358 22:26769100-26769122 CCCAGGCTGGGATGTGTGGGCGG + Intergenic
951022768 3:17798717-17798739 CCCTGTCTTTGAGGTTTGAGTGG - Intronic
951476634 3:23113382-23113404 CCCAGTCTTGCCTGGTTGGCAGG + Intergenic
951808557 3:26674720-26674742 CCCAATCTGAGATGTTTGTGGGG - Intronic
954610882 3:51943951-51943973 CCCTGTCTTGGAAGCTTGGGGGG - Intronic
961187248 3:124926467-124926489 CCCAATCTTTCATGTTTGGAGGG - Intronic
961315491 3:126032666-126032688 GCCAGACTTGGCTGTTTTGGGGG + Intronic
966334126 3:178849577-178849599 AACAGTCTTGGATGTTTGCCAGG - Intergenic
966926636 3:184648674-184648696 CCCAGGCTTGGAAGTTCTGGAGG - Intronic
975240309 4:72050030-72050052 CCCATCCTTGGAGGTTTGGATGG - Intronic
977970526 4:103208164-103208186 CCAAATCTTGGATGTAAGGGAGG - Intergenic
978400507 4:108325600-108325622 CCCAATGATGGAGGTTTGGGTGG + Intergenic
980814877 4:137932256-137932278 CCCAGTCTTGCAGTCTTGGGCGG - Intergenic
981129104 4:141138600-141138622 CCCAGTCTTCCATGTTTGTTTGG + Intronic
984862812 4:184255374-184255396 CCCAGGCTTGGTTGGTTGGTTGG - Intergenic
988108203 5:26777412-26777434 CATAGTCTAGGATCTTTGGGTGG - Intergenic
988521409 5:31948755-31948777 CCCAGCTTTGAATGGTTGGGTGG + Intronic
989102543 5:37835808-37835830 CCCAGTCTCGGACGCTTTGGAGG + Exonic
991573549 5:68079817-68079839 TCCAGTCTGGGATGTTGAGGAGG - Intergenic
992472159 5:77068797-77068819 CACAGGATTGGATGTTTGGGAGG + Intergenic
994946136 5:106394442-106394464 GCCAGTCTTGGAGTTTTGGGAGG + Intergenic
1001269179 5:170298176-170298198 CCCAGTCTTTGATGGTGGGAGGG - Exonic
1001957887 5:175860814-175860836 CTCAGTCTTTGTGGTTTGGGTGG - Intronic
1006590110 6:35148782-35148804 CACAGTCCTGGAAGTTGGGGAGG - Intergenic
1008002364 6:46373869-46373891 GGCAGTCTTGGATGTTTTAGGGG + Intronic
1021286489 7:18787349-18787371 CCCAGTTTTGGATGTATGTTAGG + Intronic
1031078227 7:117233042-117233064 CCCAGTCCTGGATGCCAGGGAGG + Intergenic
1032579738 7:133093194-133093216 CCAAGACTTGGCTGTTTGGCTGG + Intergenic
1033348201 7:140541499-140541521 CTCAGGCTTGGATGTGGGGGAGG - Intronic
1034933115 7:155179757-155179779 CCCAGTCGTGATTTTTTGGGAGG + Intergenic
1036121285 8:6020443-6020465 CCCCGTCTGGGATGTTTGGCCGG - Intergenic
1038793429 8:30689075-30689097 CCAAGTTTTGGGTGTCTGGGGGG + Intronic
1038833317 8:31087985-31088007 TCCAGTTTTGGATGGTTTGGAGG + Intronic
1041454999 8:58049497-58049519 AACAGTCTTGGATGTATGGATGG + Intronic
1042209397 8:66364510-66364532 CCCAGTCACGGATCGTTGGGCGG - Intergenic
1042443148 8:68851207-68851229 CCCAGTCTTGGAGGAAGGGGAGG + Intergenic
1043773335 8:84233102-84233124 TGCAGTCTTAGCTGTTTGGGAGG - Intronic
1047759843 8:127946130-127946152 CCCTGCCTTGGATGTGTGGCTGG - Intergenic
1048824264 8:138408610-138408632 CACAGTCTTGCATGGCTGGGGGG + Intronic
1049232394 8:141491283-141491305 CCCAGTATTTGAAGTTGGGGGGG + Intergenic
1049877951 8:145039125-145039147 CCCATTCTTATATGATTGGGTGG - Intergenic
1049989045 9:975676-975698 CCCAGTCATAGATGTCTTGGGGG - Intergenic
1055856739 9:80697239-80697261 CTCAGTGTTGGAGGTTGGGGAGG - Intergenic
1060153726 9:121304551-121304573 GCAAGTCTTGTATCTTTGGGCGG + Intronic
1062232883 9:135491993-135492015 CCCAGGCGTGGCTGTTGGGGAGG + Intergenic
1186015541 X:5188581-5188603 AACAGTTTTGGATGTTTGGGAGG + Intergenic
1187546067 X:20253417-20253439 CCCTGTCTAGGATATATGGGAGG + Intronic
1187831138 X:23381963-23381985 CACAATCTTGAATGTTTTGGGGG + Intronic
1189148131 X:38675889-38675911 ACCAGTGGTGAATGTTTGGGGGG + Intronic
1190423356 X:50308594-50308616 CTCAGTGTTGGGTGTTTTGGAGG - Exonic
1191800880 X:65077788-65077810 CCTAGTCTGGGATATTTAGGAGG + Intergenic
1191845058 X:65540950-65540972 TCCAGTCCTAGCTGTTTGGGAGG - Intergenic
1200216348 X:154369712-154369734 CTCAGTCCTGGATGGTAGGGGGG - Intronic
1201978395 Y:19879761-19879783 CCCATTCTTCCATTTTTGGGAGG - Intergenic