ID: 1089803745

View in Genome Browser
Species Human (GRCh38)
Location 11:121063659-121063681
Sequence ATGCTCTCATTTTTCTACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089803745 Original CRISPR ATGCTCTCATTTTTCTACAC TGG Intronic
902978082 1:20103721-20103743 ATTCTCTTATTTTACTGCACTGG - Intergenic
908994967 1:70140504-70140526 ATATTTTCATTTTTCTGCACTGG + Intronic
909450374 1:75791615-75791637 ATTTTCTTATTTTACTACACTGG - Intronic
911505809 1:98749218-98749240 TTTCTCTCATTTTTATACATGGG - Intronic
912927043 1:113922308-113922330 AAGCTCCTATTTTTCTATACTGG + Intergenic
914293925 1:146301124-146301146 TTCCTCTCATTTTGCTAGACTGG - Intergenic
914554969 1:148751907-148751929 TTCCTCTCATTTTGCTAGACTGG - Intergenic
914809728 1:151018320-151018342 ATCCTTTCATTTTTATAGACTGG + Intronic
914973416 1:152332826-152332848 ATTCTATCATTTTTCTAATCAGG + Intergenic
917997600 1:180457139-180457161 ATGCTCTCCTTTAGGTACACTGG - Intronic
918582227 1:186144926-186144948 GTGCTCTCATTCTTATACTCTGG - Intronic
919526573 1:198660106-198660128 ATGTTTTCATTTTTTAACACAGG - Intronic
923407618 1:233678456-233678478 ATGCTCTCATTTTACAACTTGGG - Intergenic
924483549 1:244458664-244458686 ATGCTCTAAATTTTGTTCACAGG - Intronic
1063519946 10:6732239-6732261 ATGTTTTCATTTTTCAACAAAGG - Intergenic
1064107320 10:12511085-12511107 ATGCTCACATTTTTCTTCATTGG + Intronic
1068942817 10:62696895-62696917 ATGATCTCATTTCTTTACCCTGG - Intergenic
1069011455 10:63377870-63377892 AAGATCTCACTTTTCCACACAGG - Intronic
1070312139 10:75281645-75281667 AGGCTCTCATTTTGATACCCAGG + Intergenic
1071054169 10:81490122-81490144 TGGCTCTAATTGTTCTACACTGG - Intergenic
1072525232 10:96265461-96265483 CTGCTCTCACTTTTCTACCCAGG + Intronic
1073417431 10:103396142-103396164 AGGGCCTCATTTTTCTCCACTGG + Intronic
1073755889 10:106580147-106580169 ATGCTTGTATTTTTGTACACAGG + Intronic
1074495180 10:113973969-113973991 ATCCTTTCATTTATTTACACTGG + Intergenic
1074684949 10:115952745-115952767 ATGTTCTCATTTTTCTACATGGG - Intergenic
1077708225 11:4509296-4509318 TTCCCCTCATCTTTCTACACTGG - Intergenic
1080425656 11:32151663-32151685 CAGCTCTCTTTTTTCTTCACTGG - Intergenic
1082269962 11:50159780-50159802 ATGCTCTGATTTTTCTCCCTTGG - Intergenic
1082608073 11:55266447-55266469 ATGCTTTCTTTCTTCTATACTGG - Intronic
1084875205 11:72126315-72126337 ATGCTCCAAATTTTCTTCACAGG + Intronic
1086688976 11:89767071-89767093 ACGTTCTCTTTTTTCTACAGTGG - Intergenic
1086702535 11:89916136-89916158 ATGCTTTCTTTCTTCTATACTGG + Intronic
1086703632 11:89928314-89928336 ATGCTTTCTTTCTTCTATACTGG - Intergenic
1086716880 11:90072889-90072911 ACGTTCTCTTTTTTCTACAGTGG + Intergenic
1088437501 11:109831540-109831562 ATGCAATGATTTTCCTACACAGG + Intergenic
1088600224 11:111467689-111467711 TTGCTTTCATTTATCTATACTGG - Intronic
1088970105 11:114766470-114766492 ATGCTCTAATTCTTCTATTCTGG + Intergenic
1089022867 11:115234927-115234949 AGCCCTTCATTTTTCTACACTGG - Intronic
1089803745 11:121063659-121063681 ATGCTCTCATTTTTCTACACTGG + Intronic
1091181961 11:133613398-133613420 ATGGTCTCATTTTGTTGCACAGG + Intergenic
1093020844 12:14202543-14202565 AATCAATCATTTTTCTACACAGG + Intergenic
1093609912 12:21142288-21142310 ATGCTGGCATTTTTATAAACAGG + Intronic
1095468354 12:42511241-42511263 AGGGTCTCATTATTCTACAAGGG + Intronic
1098558678 12:71848176-71848198 ATGCTTTCATTTTTCTTGATTGG + Intronic
1098614939 12:72510162-72510184 TGGCTCTTATTTTTCTAAACAGG + Intronic
1099018870 12:77378801-77378823 AAGGTCTTATTTTTCTAAACAGG - Intergenic
1100047222 12:90397781-90397803 ATGCTCTGGGTTTTCTACCCTGG + Intergenic
1100311743 12:93401787-93401809 TTCCTCTCATTTTGCTAGACTGG - Exonic
1104456289 12:128915327-128915349 ATTTTCTCATTTTTCTACAATGG - Intronic
1105041634 12:132965845-132965867 ATGTTCTCATTGTTCTTCGCTGG + Intergenic
1106627697 13:31437388-31437410 ATTCTCTTATTTTTCTTCTCAGG + Intergenic
1108225623 13:48286145-48286167 GTGCTCTCATTCCTCTTCACAGG - Intergenic
1108809882 13:54209732-54209754 ATGCTCTCATTTTCTGATACAGG + Intergenic
1109172218 13:59111047-59111069 ATACTCTCACTTTTTGACACTGG + Intergenic
1109273809 13:60282540-60282562 ATGCTTTCTTTTTTCCAAACTGG - Intergenic
1109665513 13:65530065-65530087 ATCCTCAAATTTTTCTCCACAGG - Intergenic
1111504975 13:89175862-89175884 ATGCTTTTATTTTTATACACTGG - Intergenic
1111945580 13:94661627-94661649 CTGCTCTCCTTTTTCCAAACAGG - Intergenic
1112949817 13:104979241-104979263 AGGCTCTCTATTTTCTACAATGG + Intergenic
1114382901 14:22226945-22226967 ATTATCACATTTTTCTACACAGG + Intergenic
1114633418 14:24173681-24173703 AGGCTCTCATCTCTCTGCACTGG + Intronic
1114755175 14:25251688-25251710 GTGCTCTTTTTTTTCTAGACAGG - Intergenic
1115505035 14:34085761-34085783 ATCCTCTCATTTTACTAAAGAGG + Intronic
1116381157 14:44269929-44269951 ATGTTCTCATTTTTCTAGGTAGG - Intergenic
1117336530 14:54760942-54760964 AGGCTGGCATTTTTCTGCACAGG - Intronic
1117495912 14:56303669-56303691 ATGTTCTCTTTTTTTTAAACAGG - Intergenic
1119602745 14:75988026-75988048 ATGCTCCCATGTTCCTACGCAGG - Intronic
1120670944 14:87361775-87361797 ATGCTTTCTTTTTTGTAAACTGG + Intergenic
1122077410 14:99245474-99245496 ATGATCACATTTTTGTACAAGGG + Intronic
1126048051 15:44663068-44663090 ATTCTTTCATTATTCAACACAGG - Intronic
1132075873 15:98819222-98819244 ATGATTTCATTTTTCTCGACAGG - Intronic
1132099175 15:99011031-99011053 CTGGCCTCATTTGTCTACACAGG - Intergenic
1133207786 16:4243986-4244008 ATGCTCCAAATTTTCTTCACAGG - Intergenic
1133580866 16:7143347-7143369 ATGTTCCCACTTTTCTACAGTGG - Intronic
1133693889 16:8242348-8242370 TTGCTCTTATTTTTCTTCCCTGG - Intergenic
1134852907 16:17496307-17496329 AGGCCCTCATGTTTCTACATAGG - Intergenic
1138572147 16:57882484-57882506 ATTCTTTCATTTTTCCACAGTGG + Exonic
1138728173 16:59163582-59163604 ATGGTCTTATTTATCTGCACAGG - Intergenic
1141590084 16:85062665-85062687 ATCTTCTGATTTTTCAACACTGG - Intronic
1147864423 17:43543381-43543403 ATGCTCTCATCTCTCTACCTTGG - Intronic
1148517525 17:48234471-48234493 ATGGCCTCAGTTTTCTTCACAGG - Intronic
1148526475 17:48342342-48342364 AGGCTCTCATTTTTATGCATGGG + Intronic
1149934277 17:60788753-60788775 ATACTCTCATTTATCTAAACAGG - Intronic
1150117666 17:62568466-62568488 ATGATCACAATTTTGTACACAGG - Intronic
1151143046 17:72013733-72013755 ATGCTCTCATATGTCACCACTGG + Intergenic
1151630092 17:75304745-75304767 ATGGTCTCATTTTGTTACCCAGG - Intergenic
1151898316 17:76995341-76995363 ATTTTCTCATTTTTCTACTGTGG - Intergenic
1155533238 18:26789327-26789349 ATGCCCTCCTTTCTCTTCACAGG + Intergenic
1155728253 18:29117293-29117315 ATGCTCTCATACTTCAAAACTGG + Intergenic
1155854158 18:30811247-30811269 ATGCTCTTGTGTTTCTAGACTGG + Intergenic
1156211096 18:34943612-34943634 TTGCTCTCATTTTTCCAAAGGGG + Intergenic
1156657203 18:39302884-39302906 ATGCTCTCATTTTACTATTCTGG + Intergenic
1157549922 18:48574370-48574392 ATGCACTCGTTTTTATGCACAGG - Intronic
1158046453 18:53161371-53161393 ATGCTCTCCTCATTCTACTCTGG + Intronic
1159457255 18:68675857-68675879 CTGATCTCTTTTTTTTACACCGG + Exonic
1159775514 18:72599664-72599686 ATGCTGTTATTTTTCTCTACTGG - Intronic
1160383665 18:78479969-78479991 ATGCTCTCATTTTATTAAATAGG + Intergenic
1164427225 19:28152332-28152354 AATCTATCATTTTTCTACTCAGG + Intergenic
1166210126 19:41301556-41301578 ATGGTCTCATTTTTCGTCTCTGG - Exonic
1167570746 19:50287350-50287372 ATGCTCACATTTGTGTACACGGG + Intronic
1168368230 19:55807959-55807981 CTGCTCTCTTTTTTATACAATGG - Exonic
925872995 2:8286778-8286800 CTGCTCTAATTTTGCTACAAGGG - Intergenic
928258572 2:29746534-29746556 AAGTTCTCAGTTTTCTACCCAGG + Intronic
928593648 2:32840860-32840882 ATGCTTCCATATTTCTACAAAGG + Intergenic
933136410 2:78741318-78741340 ATGCACGCATTTCTTTACACTGG - Intergenic
933418933 2:82023308-82023330 ATGCTCTGGTGTTTCTTCACTGG - Intergenic
933451570 2:82459459-82459481 GTGCTCTCCTTTTTCCAAACAGG + Intergenic
933586363 2:84183635-84183657 ATTATCTCATTTATCTGCACAGG - Intergenic
934787731 2:97026454-97026476 ATATTCTCTTTTTTCTACAGTGG - Intergenic
936828604 2:116612062-116612084 ATGGTCTCTTTTTTAAACACAGG + Intergenic
937382073 2:121387489-121387511 TTGGTCTTATTTTTCAACACTGG - Intronic
937589807 2:123599304-123599326 AGGCTCTCACTTTTTCACACAGG - Intergenic
941469645 2:165868771-165868793 ATGCCACCATTTTTCTACTCAGG + Intronic
941520181 2:166532563-166532585 ATGCTTTTATTTATTTACACAGG - Intergenic
942194191 2:173501194-173501216 ATGCTCTAAATTTTGTTCACAGG - Intergenic
942375322 2:175330665-175330687 ATGCTCTCAATCTCCTCCACTGG - Intergenic
943236283 2:185324586-185324608 CTGATCTAATTTTTCTGCACTGG + Intergenic
944281132 2:197899146-197899168 GTGCTCTCATTCTCCTCCACTGG - Intronic
946015072 2:216597605-216597627 ATTTTCTCATTTTTCTACCATGG - Intergenic
946553217 2:220825072-220825094 ACTCTCTCATCTTTCTACTCTGG + Intergenic
947855069 2:233318360-233318382 AGGCTCTCATTTTGTTACCCAGG + Intronic
1169468356 20:5861234-5861256 ATGCACTCATTCTGCTACCCTGG + Intronic
1174316202 20:49703992-49704014 ATTCTGTCATTTTTCTGAACAGG + Intronic
1174619783 20:51865222-51865244 ATCCTCCCCTTTATCTACACTGG + Intergenic
1174619798 20:51865294-51865316 CTTCTCTCCTTTATCTACACTGG + Intergenic
1174721475 20:52817549-52817571 AAGCTCTTATTTTTTTTCACAGG - Intergenic
1175452136 20:59078395-59078417 ATTCTCTCATTTTGCTCTACGGG + Intergenic
1177571540 21:22893434-22893456 TTGCTCTCCTTTTCCTACAATGG + Intergenic
1181673929 22:24439868-24439890 ATTCTCTCATTTCTCTCCAGAGG + Intronic
1182824797 22:33255499-33255521 ATGCTCTCATTTTGCCAGGCTGG - Intronic
1184894856 22:47400922-47400944 ATTCTCTCACATTTCAACACCGG + Intergenic
949624276 3:5849833-5849855 CTGCTTTCATATTTCTACAGGGG + Intergenic
950238680 3:11347855-11347877 ATGATCTCCTGTTTCCACACAGG + Exonic
951216701 3:20032018-20032040 ACACTGTCATTTTTATACACTGG + Intergenic
952224007 3:31355429-31355451 ATACTTTCATTTTTCTGCATAGG - Intergenic
955051606 3:55416157-55416179 ATGCTCTCATTTTACCTCAGAGG + Intergenic
956313526 3:67908375-67908397 ATGGTATCATTTTTCTTCTCAGG + Intergenic
956589956 3:70904250-70904272 GGGCTCTCATTTATCAACACAGG + Intergenic
956853837 3:73256697-73256719 ATATTCTCATTTTTCTAGAAAGG + Intergenic
961001208 3:123375305-123375327 ATACTCTCATTTTTCCTCAGTGG + Intronic
961034576 3:123633579-123633601 ATGCTTTACTTTTTCTTCACTGG + Intronic
961041994 3:123684059-123684081 ATGATTTCATTTTCTTACACTGG + Intronic
961822820 3:129584023-129584045 ATGCTATGATTTTTCTTCTCAGG + Intronic
962678586 3:137775398-137775420 ATGATTTCATTCTTCTTCACTGG + Intergenic
962803048 3:138906564-138906586 AAGATCTCATCTTTCAACACTGG + Intergenic
963895232 3:150678711-150678733 ATGTTCTCATTTTTTGACAAGGG - Intronic
964409278 3:156381439-156381461 ATGCTCTATTCTCTCTACACTGG - Intronic
964655643 3:159063497-159063519 TTGCTCTCATTTATGTCCACTGG + Intronic
964682204 3:159354513-159354535 ATGCTCTAAATTTTATAAACTGG + Intronic
965421410 3:168463726-168463748 AACATCTCATTTTTCCACACTGG - Intergenic
965667852 3:171115211-171115233 ATGCTCTGAGTTTTCTTCCCTGG + Intronic
966210817 3:177451517-177451539 ATGCTCTCATCTAACTCCACAGG - Intergenic
966442010 3:179955914-179955936 ATGTGTTCATTTTTCTACAGGGG + Intronic
967328863 3:188270205-188270227 ATGCTTTCCTTTTTCTCAACTGG + Intronic
967700485 3:192586708-192586730 ATCCTCTCATTTTTGTAGAGAGG + Intronic
971324089 4:25629813-25629835 TAACTCTCATTTTTCCACACAGG + Intergenic
971568340 4:28175153-28175175 ATGTTCTCATTTATCCACCCAGG + Intergenic
971672940 4:29587184-29587206 ATTCTCTGTTCTTTCTACACAGG - Intergenic
972216112 4:36898809-36898831 ATGCTCTAAATTTTGTTCACAGG - Intergenic
973169958 4:47129811-47129833 ATTCTCTCTTTTTTCTTCCCTGG - Intronic
974739708 4:65990542-65990564 ATTCTCTCATTATTATACAGAGG - Intergenic
974822134 4:67080744-67080766 ATTCTCTCATTTCTCTTCTCAGG - Intergenic
975021294 4:69493229-69493251 ATACTCTCTATTATCTACACTGG + Intronic
975789119 4:77929300-77929322 ATGCTATCATATTTATCCACTGG - Intronic
976431835 4:84971273-84971295 TTGCTCTCATTTTTGTAAACAGG - Intergenic
976638751 4:87314855-87314877 TTTCTCTCATTGTTCTACAGAGG + Intronic
978328801 4:107588715-107588737 ATGCTCCAAATTTTCTTCACAGG + Intergenic
978972011 4:114820236-114820258 ATGATCTTATATTTTTACACTGG - Intergenic
980015736 4:127648090-127648112 ATTTTCTCATATTTCTACCCAGG + Intronic
980722908 4:136720634-136720656 CTGCTCTCCTCTTTCTACATGGG + Intergenic
981268074 4:142811012-142811034 CTGCTGACATTTTTCTGCACTGG + Intronic
981406961 4:144383024-144383046 ATACTCTCATTTTTCAACTGAGG - Intergenic
981800991 4:148655185-148655207 ATCCTCTCATTTTTCAACTCTGG - Intergenic
982552854 4:156824265-156824287 ATGCTTACATTGTTCTAGACGGG - Intronic
985191451 4:187378440-187378462 ATCCTCTCATGTTTCTAATCGGG - Intergenic
986035852 5:3937817-3937839 ATTCTCTCATTTTTTTAGCCAGG + Intergenic
987165971 5:15198319-15198341 ATGCTCTAAATTTTGTTCACAGG + Intergenic
987919002 5:24254060-24254082 ATGGTCTAATTTTTCTGCAAGGG - Intergenic
989692091 5:44156900-44156922 ATGCTCCAAATTTTGTACACAGG - Intergenic
990269770 5:54124262-54124284 ATGCTCTTCTTATTCTAGACAGG + Intronic
991070497 5:62474096-62474118 CTGCTTTAATTTTTCTTCACAGG - Intronic
992429059 5:76689951-76689973 ATGGGCTCATTTATCTACAGTGG + Intronic
995230554 5:109756698-109756720 ATGCTAACTATTTTCTACACGGG - Intronic
996385676 5:122907603-122907625 TTGCGGTCATTTATCTACACTGG + Intronic
1001490688 5:172152892-172152914 ATGATCATATTTTTATACACTGG + Intronic
1010104780 6:72154797-72154819 ATGTTCTCATTTTTCCCCATGGG - Intronic
1010778340 6:79912296-79912318 ATGCTCTCTTTTTTCTCCCATGG + Intergenic
1011000175 6:82579696-82579718 ATGCTCTGATGTTTCCAAACAGG - Intergenic
1011310692 6:85976440-85976462 ATGTTGTCTTTTATCTACACTGG - Intergenic
1012656005 6:101821533-101821555 AAGCTCTCATTTTAATAAACAGG + Intronic
1012709961 6:102586337-102586359 AGGGTCTCATTCTGCTACACAGG + Intergenic
1013874446 6:114806190-114806212 GTATTCTTATTTTTCTACACAGG + Intergenic
1014293790 6:119592847-119592869 ATGATCTCCTTTGTATACACTGG - Intergenic
1014696216 6:124624305-124624327 ATGCTCTTATTCTTCTAGAGTGG - Intronic
1019220822 6:170471422-170471444 ATGCACACATATTTGTACACGGG - Intergenic
1019234877 6:170603334-170603356 ATGCTCTGATGGTTCTACAAGGG + Intergenic
1019800840 7:3087270-3087292 ATGCTGTCATTGTCCTACCCTGG + Intergenic
1021320861 7:19209412-19209434 ACTCTGTCATTTTTCTTCACAGG + Intergenic
1021504073 7:21361518-21361540 ATGCTTTCATCTGTCAACACAGG - Intergenic
1022322218 7:29297934-29297956 CTGCTCTCCTCTTTCTAGACGGG - Intronic
1025726637 7:64068328-64068350 AGGCTCTCATCTTTCTTTACTGG + Intronic
1027421665 7:78023029-78023051 ATATTTTCATTTTTCTGCACAGG + Intronic
1027659296 7:80970033-80970055 ATGATCTCATTTTTCATTACTGG + Intergenic
1028656689 7:93216886-93216908 GTGCTCATATTTTTCTACACTGG + Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030962315 7:115941145-115941167 TTGGTCTCATTGTTCTACAAAGG + Intronic
1031230444 7:119099073-119099095 TTTCTCGCCTTTTTCTACACTGG + Intergenic
1031906800 7:127469136-127469158 ATGATTTTGTTTTTCTACACTGG - Intergenic
1033917728 7:146348092-146348114 ATGATATTATTTTTCCACACTGG + Intronic
1033966162 7:146976985-146977007 ATCCACTCATTTTTCTCCCCAGG - Intronic
1034140569 7:148811644-148811666 ATGAATTCATTTTTCTGCACAGG + Exonic
1035851239 8:2921243-2921265 ATGGTCTCATTTTTTTGCCCAGG - Intergenic
1035892654 8:3362438-3362460 ATGCTCTCTTTTTTCTCCAAAGG + Intronic
1036041754 8:5091250-5091272 AATGTCTCATTTTTATACACTGG + Intergenic
1037205248 8:16309682-16309704 ATATTCTCATCTTTCTACAGAGG - Intronic
1038067627 8:23979606-23979628 TTGTTCTCATTTTTCTTCATAGG + Intergenic
1040560799 8:48521802-48521824 ATGCTTTCATTATGCTACAATGG - Intergenic
1042095760 8:65214151-65214173 ATATTCTCATTCTTCCACACTGG + Intergenic
1042213314 8:66403356-66403378 TTGCTCTTCTTTTTCTACATGGG + Intergenic
1044272096 8:90258267-90258289 ATGGGTTCATTTTTGTACACAGG - Intergenic
1046998393 8:120549047-120549069 CTGCTCTCATTTTTCTGGTCTGG + Intronic
1050188054 9:2996035-2996057 CTCCTCTCATTTTTCTACCTGGG + Intergenic
1050523089 9:6521949-6521971 ATGTCTTCATTTTTTTACACTGG + Intergenic
1052405219 9:28051087-28051109 CTGCTTTCCTTTTCCTACACAGG + Intronic
1054820676 9:69517256-69517278 GCGCTCTCATTTTGCTCCACTGG + Exonic
1055207745 9:73752771-73752793 ATGCTTTCACTCTTGTACACTGG + Intergenic
1055384163 9:75743075-75743097 ATACTCTCATTTTTATACTGAGG - Intergenic
1055411080 9:76030038-76030060 ATGCTCTAAATTTTATTCACAGG + Intronic
1058304257 9:103417545-103417567 ATTCTGTTATTTTTCTAGACGGG + Intergenic
1060767267 9:126304305-126304327 ATGTTCACCTTTTGCTACACAGG + Intergenic
1061472710 9:130839858-130839880 AGGGTCTCATTCTTCTGCACAGG + Intronic
1061736699 9:132665800-132665822 ATTCTCTCATTTATCAACACAGG + Intronic
1187665637 X:21606306-21606328 ATGCTCTCAATTCTCTTCTCTGG - Intronic
1190726069 X:53191622-53191644 ATTCCCTGATTTTTCTCCACAGG - Intronic
1196344503 X:114637627-114637649 ATGCTCTTATTTTGCCACAGTGG - Intronic
1196384691 X:115136672-115136694 CTGCTCTTTGTTTTCTACACAGG - Intronic
1197065622 X:122230690-122230712 ATGCTCCAAATTTTCTTCACAGG - Intergenic
1198605760 X:138334838-138334860 TTGCTCTAATTTTCCTAAACTGG - Intergenic
1199300217 X:146204686-146204708 ATGCTCTCTTTTTCCTTCACGGG + Intergenic
1201470745 Y:14332105-14332127 ATGCTCTCAGTTTACAATACTGG - Intergenic