ID: 1089806186

View in Genome Browser
Species Human (GRCh38)
Location 11:121092974-121092996
Sequence CCACCTTAGCATCTGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089806186_1089806196 30 Left 1089806186 11:121092974-121092996 CCAGGAAGCAGATGCTAAGGTGG No data
Right 1089806196 11:121093027-121093049 TAACACCTGTGAAGGAACAGGGG No data
1089806186_1089806193 22 Left 1089806186 11:121092974-121092996 CCAGGAAGCAGATGCTAAGGTGG No data
Right 1089806193 11:121093019-121093041 CTGGGGAGTAACACCTGTGAAGG 0: 2
1: 0
2: 0
3: 17
4: 151
1089806186_1089806195 29 Left 1089806186 11:121092974-121092996 CCAGGAAGCAGATGCTAAGGTGG No data
Right 1089806195 11:121093026-121093048 GTAACACCTGTGAAGGAACAGGG No data
1089806186_1089806192 5 Left 1089806186 11:121092974-121092996 CCAGGAAGCAGATGCTAAGGTGG No data
Right 1089806192 11:121093002-121093024 GGAGTGCAGAAAATTTGCTGGGG No data
1089806186_1089806194 28 Left 1089806186 11:121092974-121092996 CCAGGAAGCAGATGCTAAGGTGG No data
Right 1089806194 11:121093025-121093047 AGTAACACCTGTGAAGGAACAGG No data
1089806186_1089806190 3 Left 1089806186 11:121092974-121092996 CCAGGAAGCAGATGCTAAGGTGG No data
Right 1089806190 11:121093000-121093022 TGGGAGTGCAGAAAATTTGCTGG No data
1089806186_1089806191 4 Left 1089806186 11:121092974-121092996 CCAGGAAGCAGATGCTAAGGTGG No data
Right 1089806191 11:121093001-121093023 GGGAGTGCAGAAAATTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089806186 Original CRISPR CCACCTTAGCATCTGCTTCC TGG (reversed) Intergenic
No off target data available for this crispr