ID: 1089806424

View in Genome Browser
Species Human (GRCh38)
Location 11:121094591-121094613
Sequence CCATTATTAGCAGGTTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089806413_1089806424 25 Left 1089806413 11:121094543-121094565 CCAATTGGTCTCCCCAACAGTAA No data
Right 1089806424 11:121094591-121094613 CCATTATTAGCAGGTTGAACAGG No data
1089806419_1089806424 12 Left 1089806419 11:121094556-121094578 CCAACAGTAACATATTGGGGTTT No data
Right 1089806424 11:121094591-121094613 CCATTATTAGCAGGTTGAACAGG No data
1089806418_1089806424 13 Left 1089806418 11:121094555-121094577 CCCAACAGTAACATATTGGGGTT No data
Right 1089806424 11:121094591-121094613 CCATTATTAGCAGGTTGAACAGG No data
1089806417_1089806424 14 Left 1089806417 11:121094554-121094576 CCCCAACAGTAACATATTGGGGT No data
Right 1089806424 11:121094591-121094613 CCATTATTAGCAGGTTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089806424 Original CRISPR CCATTATTAGCAGGTTGAAC AGG Intergenic
No off target data available for this crispr