ID: 1089807441

View in Genome Browser
Species Human (GRCh38)
Location 11:121104157-121104179
Sequence ATGAAGGATAAATCCATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089807435_1089807441 16 Left 1089807435 11:121104118-121104140 CCTCATTCATACTTGGGCATGAC 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1089807441 11:121104157-121104179 ATGAAGGATAAATCCATGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 191
1089807434_1089807441 17 Left 1089807434 11:121104117-121104139 CCCTCATTCATACTTGGGCATGA 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1089807441 11:121104157-121104179 ATGAAGGATAAATCCATGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 191
1089807437_1089807441 -8 Left 1089807437 11:121104142-121104164 CCTAAAAAGTTCCCCATGAAGGA 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1089807441 11:121104157-121104179 ATGAAGGATAAATCCATGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089807441 Original CRISPR ATGAAGGATAAATCCATGCC AGG Intronic
905161433 1:36038548-36038570 CTTAAGAATAAATCCAGGCCGGG - Intronic
905743985 1:40397861-40397883 ATGAGGGAGAAAGCCATTCCAGG + Intronic
906093157 1:43199977-43199999 AAGAAGGATAAATCCTTACAAGG - Intronic
909006594 1:70283519-70283541 AAGAAAAAAAAATCCATGCCGGG + Intronic
909271340 1:73627271-73627293 CTGAAGGAAGAATCCAGGCCTGG + Intergenic
909684673 1:78334020-78334042 AAGAAGGAGAAATACATTCCTGG - Intronic
913000633 1:114577148-114577170 ATGAAGGCTCAATCCATTCATGG + Intronic
913144738 1:115977462-115977484 GTGAAGGACTAATCCTTGCCTGG - Intronic
914924702 1:151874240-151874262 ATGAAGAATAAATACATGGTGGG - Exonic
917027109 1:170656484-170656506 TTGCAGGAAAAATTCATGCCTGG - Intergenic
921105332 1:211971257-211971279 CTGGAGGATAAAACCATCCCTGG + Intronic
921576381 1:216840058-216840080 AGAAAGGAGAAATCAATGCCTGG - Intronic
921824203 1:219653644-219653666 ATGAAGGATAAATACTTGAGGGG - Intergenic
922411683 1:225382409-225382431 TTAAAGCATAAATCCAGGCCGGG + Intronic
923638502 1:235725571-235725593 ATTTAGGTTAAATCCATGTCTGG + Intronic
924899051 1:248374902-248374924 TTAAATGATAAATCTATGCCTGG - Intergenic
924936226 1:248773829-248773851 AGGCAGGATAACTCCAGGCCGGG - Intergenic
924946300 1:248849185-248849207 ATGAAGGATGTCTCCATGCTAGG + Exonic
1063253800 10:4303917-4303939 ATGAAAGATAAAACAAAGCCTGG - Intergenic
1063698572 10:8362189-8362211 ATGAAGGACAAAACCTTCCCAGG - Intergenic
1063972554 10:11391376-11391398 ATGAAGGATAAATGCTTGAGGGG + Intergenic
1067265232 10:44736097-44736119 ATGAAGGATAAATGTATGAGGGG - Intergenic
1069343690 10:67441727-67441749 ATGAAGGAGAAATACTTTCCTGG + Intronic
1070007848 10:72442616-72442638 ATGAAGGAGAACAACATGCCAGG - Intronic
1070600118 10:77860072-77860094 GTGAAGGTGAAATCAATGCCTGG - Intronic
1071903673 10:90148384-90148406 CTGAAGGATAAATCAAGGTCCGG + Intergenic
1073598245 10:104821331-104821353 ATGAGGGATAACTCCCTGCTGGG + Intronic
1075269838 10:121039073-121039095 TAGAGGGATAAATCCATGTCTGG - Intergenic
1075661526 10:124200277-124200299 ATGAAGGATAGAGCCATGCAGGG + Intergenic
1076083102 10:127601043-127601065 ATGATGGATAACTCTATGACAGG - Intergenic
1078160767 11:8837851-8837873 ATGATGGAGAAATCAAAGCCAGG + Intronic
1080466201 11:32499679-32499701 ATAAAGGAAAAAGCCATTCCAGG + Intergenic
1081191785 11:40112904-40112926 CTGAAGGATGAATACATACCAGG - Intergenic
1082068271 11:47918216-47918238 ACGAAGGGTAAATGGATGCCAGG + Intergenic
1082068603 11:47920558-47920580 AAGAAGGGTAAATGGATGCCAGG + Intergenic
1082103448 11:48193715-48193737 ATTAAGGAAAATTTCATGCCTGG + Intergenic
1082922977 11:58515976-58515998 AGGAAGGAGAAATTGATGCCTGG - Intergenic
1089807441 11:121104157-121104179 ATGAAGGATAAATCCATGCCAGG + Intronic
1092038132 12:5359091-5359113 ATCAATGAGAAATCAATGCCTGG - Intergenic
1093681632 12:22009502-22009524 ATGAAGAATAAATACATGGCGGG + Intergenic
1093885135 12:24450786-24450808 ATAAAGGATAAATACTTGGCTGG - Intergenic
1094274315 12:28654139-28654161 ATAAAAGATATATACATGCCCGG + Intergenic
1095118648 12:38385915-38385937 ATAAAGTATAATTCCATGCTGGG - Intergenic
1097706655 12:62875760-62875782 AAGAAGCATAAAACCATGCCAGG - Intronic
1098234303 12:68403770-68403792 AAGAAGGATAAATACATACATGG - Intergenic
1099065241 12:77969035-77969057 ATGAAAGATAACTACATGACAGG - Intronic
1099135095 12:78887529-78887551 AGGAAAGAGAAATCCATGCATGG + Intronic
1099304267 12:80936133-80936155 AAGCAGGATAAATCCATTGCCGG - Intronic
1099517027 12:83609771-83609793 ATGGAGGATAACTCAGTGCCTGG - Intergenic
1100651024 12:96588650-96588672 ATGAAGTATAAATGCATTCATGG - Intronic
1102775199 12:115512550-115512572 ATGAAGCAAAAATCTATGCAAGG - Intergenic
1105956702 13:25289849-25289871 ATGGAGCATAAATCCTTGACGGG + Intergenic
1106505761 13:30369301-30369323 ATGAGGGAAAAAGCCAAGCCAGG - Intergenic
1107573217 13:41685891-41685913 AGGAAGGATAAATACATACGTGG - Intronic
1107653306 13:42566696-42566718 ATGAAGCATAAATAAAGGCCAGG + Intronic
1108171109 13:47743020-47743042 ATGAAGGATAAATGATTGCAGGG + Intergenic
1109830385 13:67778725-67778747 GTGAAGGATAAGTCCATTTCTGG + Intergenic
1111189991 13:84794561-84794583 GTGAAAGATAAATCCATGGCTGG + Intergenic
1111278412 13:85984479-85984501 ATAAAGGAGAAATCAATGTCTGG - Intergenic
1114808708 14:25870314-25870336 ATGAAGGCTAAAACAAAGCCAGG + Intergenic
1115698746 14:35927649-35927671 AGGAAGTTTAAAGCCATGCCAGG - Intronic
1116226657 14:42162075-42162097 ATGAAAGGCAAATCCATGTCCGG + Intergenic
1120176860 14:81303684-81303706 ATGAAGGCAAAATCCAGTCCAGG - Intronic
1120576899 14:86193444-86193466 AGGAAGGTTAAACCCATTCCAGG + Intergenic
1123462117 15:20482500-20482522 AAGAAGAATAAATACTTGCCAGG + Intergenic
1123655939 15:22517872-22517894 AAGAAGAATAAATACTTGCCAGG - Intergenic
1124185501 15:27524295-27524317 ATAAAGGAGAAATCCATTCTCGG + Intronic
1124309848 15:28613054-28613076 AAGAAGAATAAATACTTGCCAGG - Intergenic
1127087954 15:55441990-55442012 ATGAAGAATAAATACATGGCAGG - Intronic
1130037738 15:80377033-80377055 AGGAAGGAGAGCTCCATGCCTGG + Exonic
1135601263 16:23785632-23785654 ATAAAAGATAAAACAATGCCAGG - Intergenic
1138737128 16:59263476-59263498 ATGAAGGATAAACACATGTTAGG - Intergenic
1141560401 16:84864010-84864032 AAGAAAGAAAAATGCATGCCGGG + Intronic
1144556223 17:16285289-16285311 AGAAAGGAAAAATCCAGGCCGGG + Intronic
1147891769 17:43722383-43722405 ATGGAGGCTGAATCCAGGCCAGG - Intergenic
1149935351 17:60799959-60799981 ATGAATGGTACATCCATACCAGG - Intronic
1151243888 17:72779517-72779539 GTGTAGGATAAATCCTTTCCTGG + Intronic
1151309634 17:73285464-73285486 ATGAAGGAGAACTCCTTGTCTGG + Exonic
1151502272 17:74498468-74498490 CTGAAGGATATTTCCATACCAGG - Intergenic
1152045607 17:77933151-77933173 AGGAAGGATAAAACCAGCCCTGG - Intergenic
1153860098 18:9194011-9194033 ATGAATTATAAATCCATTTCTGG + Intronic
1154396993 18:13999587-13999609 ATGCAGGATGAATTCATGCAGGG + Intergenic
1157711242 18:49851153-49851175 AGGAAAGATTAATCCAGGCCAGG + Intronic
1159031333 18:63235579-63235601 GTGAAAGATAAAACCATGCATGG + Intronic
1159031347 18:63235830-63235852 GTGAAAGATAAAACCATGCATGG - Intronic
1159640929 18:70862210-70862232 TTTAATGACAAATCCATGCCTGG - Intergenic
1160448963 18:78949021-78949043 AGGAAGGGGAAATCCGTGCCTGG - Intergenic
1163033259 19:14558048-14558070 ATTAAGGATAAATATAGGCCGGG - Intronic
1163172391 19:15541304-15541326 ATGAAGGATGAATCTGTTCCAGG + Intronic
1165599353 19:37040047-37040069 AGAGAGGATAAGTCCATGCCTGG - Intronic
1166069489 19:40378743-40378765 ATGAGTGCTAAGTCCATGCCGGG - Intronic
926800422 2:16655307-16655329 ATGAAGTCTAAAGCCATTCCTGG - Intronic
931989833 2:67779062-67779084 ATGAAGGATGAGTCCAGGTCGGG + Intergenic
934865103 2:97801479-97801501 ATGAATGCTAAACCCATGACTGG - Intronic
935014105 2:99163646-99163668 CTGAAATATAAATACATGCCAGG - Intronic
937808827 2:126177114-126177136 ATCAAGGAGAAATACATGGCTGG + Intergenic
939181027 2:138802892-138802914 ATGAAGGAGCAATCCATGGGTGG - Intergenic
943913013 2:193592495-193592517 GTGAAGAATAAAGCCATGCTGGG + Intergenic
946443318 2:219715206-219715228 ATAGAGGCCAAATCCATGCCAGG + Intergenic
948483219 2:238263403-238263425 GTTAAGCAAAAATCCATGCCAGG - Intronic
1169388031 20:5167652-5167674 ATTAAGGATAAACCCATCTCTGG + Intronic
1172621872 20:36322877-36322899 ATGCAGGATATTTCCAGGCCAGG + Intronic
1174513947 20:51076816-51076838 ATGAAGGATAACTCGAGGCAGGG + Intergenic
1174895373 20:54443732-54443754 AAGAAGGATATATTCATGCGAGG + Intergenic
1175352852 20:58337818-58337840 ATGAAGAATAAAACCCAGCCTGG + Intronic
1177038663 21:16077936-16077958 ATGAAGCATAAATACATCTCTGG - Intergenic
1178739200 21:35181575-35181597 AAGGAGGATAAATACATTCCTGG + Intronic
1180929827 22:19581805-19581827 ATGAATGTTGAAGCCATGCCCGG + Intergenic
1182069982 22:27456705-27456727 ATGTAAAATAACTCCATGCCAGG + Intergenic
1182915389 22:34024587-34024609 AGGAAGGATAAACCTGTGCCTGG - Intergenic
1182927289 22:34137411-34137433 ATGAAAAATAAATCTAGGCCAGG - Intergenic
1184142126 22:42584040-42584062 AGGGAGGATAAAGCCATGCAGGG + Exonic
949872904 3:8604378-8604400 ATGAAAAAAAAATCCATTCCCGG - Intergenic
951213534 3:20002108-20002130 ATGAAAGATATTTACATGCCAGG + Intronic
953275121 3:41488074-41488096 ATGAAGTAGAAATACATGCAAGG + Intronic
954373041 3:50179250-50179272 ATCAAGGAGAAATCAATTCCTGG - Intronic
955026813 3:55175524-55175546 ATGAAGATTTAATTCATGCCAGG - Intergenic
957677381 3:83385434-83385456 ATGCATGATAAATCAAGGCCTGG - Intergenic
957773708 3:84728420-84728442 ATGATACATAAATACATGCCGGG - Intergenic
959596546 3:108135327-108135349 ATGAATGACATCTCCATGCCAGG - Intergenic
959623078 3:108420212-108420234 ATGGAGGATCAATAAATGCCAGG + Intronic
959915037 3:111807419-111807441 AAGAAGCATGAATCCCTGCCAGG + Intronic
960833347 3:121875719-121875741 AAGAATGATAAAACAATGCCAGG + Intronic
962916874 3:139912374-139912396 TGGAAGGAAAAATCCAGGCCAGG - Intergenic
963166399 3:142208852-142208874 ATAAAGGATAAATAGAGGCCGGG + Intronic
963186978 3:142429441-142429463 ATTACGGCTAAATCCAGGCCGGG - Intronic
965438512 3:168683497-168683519 ATAAAGGATAAATCCTTGAGGGG + Intergenic
966033659 3:175382294-175382316 TTGAAGGGTAAACACATGCCTGG + Intronic
969396817 4:6927126-6927148 GTGAAGGACAAATGCAAGCCGGG - Intronic
971972909 4:33643355-33643377 AAGAAGGATATCTCCATCCCTGG - Intergenic
973302042 4:48596653-48596675 ATGAACGTTTAATACATGCCAGG - Intronic
975169981 4:71222510-71222532 ACGAAGGATGAATCCATGGTGGG - Intronic
975614362 4:76231714-76231736 TTTGAGGATAAACCCATGCCTGG - Intronic
976103045 4:81586321-81586343 GTTAAGAATAAATCCAGGCCGGG + Intronic
976380261 4:84390897-84390919 CTGAAGGATAAAGCAGTGCCGGG + Intergenic
979236149 4:118402563-118402585 AGGAAGGAGAAATCCAAGCAGGG + Intergenic
979836989 4:125382701-125382723 ATAGAGGAGAAATCAATGCCTGG - Intronic
979846195 4:125515535-125515557 ATAAAGGAGAAATCCATGCCTGG - Intergenic
980347198 4:131636252-131636274 TTGAAGGAAAAAACCATTCCAGG + Intergenic
980618781 4:135269654-135269676 ATGAATGATTAATCCATTCATGG - Intergenic
982088595 4:151861264-151861286 ATGAACAATAAACCCATTCCAGG - Intergenic
984898920 4:184567012-184567034 AGAGAGGATAAGTCCATGCCTGG - Intergenic
985111298 4:186548306-186548328 ATGAAAGTTAAATCAATGACAGG + Intronic
986432703 5:7697325-7697347 ATGATGGATAAACCAATGGCTGG - Intronic
987619440 5:20321214-20321236 AAGAGGCAGAAATCCATGCCTGG + Intronic
987773826 5:22338586-22338608 ATGAAGGATAAATGCTTGAGAGG + Intronic
989331984 5:40270413-40270435 ATGAAGGAGAAATGCTTCCCTGG + Intergenic
989611469 5:43297543-43297565 ATGAAGATTAAATACAGGCCAGG + Intronic
991357819 5:65788214-65788236 ATGATGGGAAAATCAATGCCTGG + Exonic
991456179 5:66807145-66807167 ATGAAGGATAAATGCTTGAGGGG - Intronic
991534203 5:67648738-67648760 ATCAAGGATGCATCCATGCAGGG - Intergenic
993000750 5:82378393-82378415 ATGAATGAAAAATCAATGTCTGG - Intronic
993026553 5:82653724-82653746 ATGGAGGACAAAGCCATGCTGGG - Intergenic
993084746 5:83349602-83349624 CTGAAGGATAAATAGATTCCTGG - Intronic
994319106 5:98369398-98369420 ATGAAGATTAAATGCTTGCCAGG + Intergenic
996841911 5:127856051-127856073 AGAAAGGAGAAATCAATGCCTGG - Intergenic
999853072 5:155563903-155563925 ATAAAGGTTAAATGCATGCAAGG - Intergenic
1000437314 5:161229064-161229086 AGGAAGGAAAAATTCATTCCAGG - Intergenic
1004889231 6:20082733-20082755 AGGAAGGCTAAATCCTTCCCTGG - Intergenic
1006216520 6:32448588-32448610 AAGAAGGATAAATTGAGGCCAGG + Intergenic
1006430676 6:33993720-33993742 ATGGAGGAAAAATCGATACCTGG - Intergenic
1006765939 6:36507162-36507184 ATGAAGGACAAATCTAGCCCAGG + Intronic
1008311139 6:49975760-49975782 ATAAATGATGAATTCATGCCTGG + Intergenic
1010120843 6:72374439-72374461 ATGAAGAATCATTCCATGACTGG - Intronic
1011737311 6:90324320-90324342 AGAAAGGATAAGTCAATGCCTGG - Intergenic
1012694813 6:102365647-102365669 ATGAAGGTTAAATTCTAGCCAGG + Intergenic
1014002040 6:116374808-116374830 ATGAATGATTAATCCATTCATGG - Intronic
1017360156 6:153559319-153559341 ATGAAGGAGAAATGAATGCTAGG - Intergenic
1020020334 7:4862585-4862607 ATTAAAGAGAAATCTATGCCTGG - Intronic
1022418097 7:30195549-30195571 ATGAAGCATATGACCATGCCAGG + Intergenic
1023106658 7:36769667-36769689 ATGAAGGAGAAAGGCCTGCCAGG + Intergenic
1028780730 7:94733274-94733296 AGGAAGGATACATCCAAGACTGG + Intergenic
1029562423 7:101311713-101311735 ATGAAAAATAACTCCATGGCTGG + Intergenic
1031807350 7:126324422-126324444 ATGATGCATAAATCCAATCCTGG - Intergenic
1031950743 7:127889485-127889507 ATGAAGGATAAATACTTGAGAGG - Intronic
1038756272 8:30343605-30343627 ATGGAGGACAAATGGATGCCAGG - Intergenic
1039798991 8:40938291-40938313 ATGAAAAATGAATCCAGGCCAGG + Intergenic
1039937573 8:42059740-42059762 AAGAATGAAAAATACATGCCAGG + Intergenic
1041216357 8:55605245-55605267 ATGAAGGCAAAATACATCCCGGG + Intergenic
1042635768 8:70872588-70872610 ATAAAGGAGAAATCAATGCCTGG + Intergenic
1046169492 8:110486160-110486182 GTGAAGGACAAAGCCATGGCTGG + Intergenic
1046474407 8:114722661-114722683 ATTAAAGAAAAATCCAGGCCTGG - Intergenic
1046553177 8:115742677-115742699 AAGAAGGTTAAATTCATGCATGG + Intronic
1047532188 8:125686771-125686793 AGGAAGGAAAAAACCATTCCAGG - Intergenic
1048156424 8:131959236-131959258 ATGAAGGACAAATACAAGGCTGG - Intronic
1048320569 8:133396543-133396565 TTGAAGGATTATTCTATGCCAGG + Intergenic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1051408081 9:16760530-16760552 ATCCAGGATAAATCCAAGCCTGG + Intronic
1051520538 9:17982317-17982339 ATTAAGAATAAAACCAGGCCAGG + Intergenic
1052617713 9:30863851-30863873 ATGAATAATAAATCCATTTCAGG - Intergenic
1188664148 X:32798131-32798153 ATAAAGGGTAAATTCAAGCCAGG + Intronic
1188678285 X:32970336-32970358 ATGAAGGATAAATGCTTGAGGGG + Intronic
1189556118 X:42147325-42147347 ATGAAGCAAAATTCCATGCCTGG + Intergenic
1190865693 X:54382732-54382754 ATTAAAAATAAATCCTTGCCGGG + Intergenic
1193531677 X:82662016-82662038 ATGAACCATAAACCCATGACTGG + Intergenic
1194332319 X:92599212-92599234 ATGAAGGATAAATGCTTGAGGGG + Intronic
1194635018 X:96335302-96335324 TTGAAGGATAAATCCCTGAAGGG - Intergenic
1195489464 X:105450159-105450181 ATGAAGAATAAAGCCATGTTGGG - Intronic
1196003421 X:110810525-110810547 ATGAAGGATAAATGCTTGAGGGG - Intergenic
1196404929 X:115351132-115351154 AAGAAGGATAAGTCCATTCCTGG + Intergenic
1199032857 X:143021452-143021474 ATGAAGGATAAATGCTTGAAGGG + Intergenic
1199459876 X:148072645-148072667 CTGAAGGCTAAATCCCTGCCTGG - Intergenic
1200641024 Y:5718263-5718285 ATGAAGGATAAATGCTTGAGGGG + Intronic