ID: 1089807724

View in Genome Browser
Species Human (GRCh38)
Location 11:121106439-121106461
Sequence CTACAGACCCATATTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089807724_1089807731 20 Left 1089807724 11:121106439-121106461 CCACCCTCAATATGGGTCTGTAG 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1089807731 11:121106482-121106504 GCCCAACCCACACTAAGAAATGG 0: 1
1: 0
2: 5
3: 13
4: 124
1089807724_1089807729 -10 Left 1089807724 11:121106439-121106461 CCACCCTCAATATGGGTCTGTAG 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1089807729 11:121106452-121106474 GGGTCTGTAGATAGGCCAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089807724 Original CRISPR CTACAGACCCATATTGAGGG TGG (reversed) Intronic
900726189 1:4217892-4217914 CTGCAGACCAAGAGTGAGGGAGG + Intergenic
902938340 1:19780923-19780945 CTACAGACCAGGATGGAGGGAGG + Intronic
906990024 1:50727737-50727759 ATACCCACCCAGATTGAGGGTGG - Intronic
909794376 1:79714838-79714860 CCACACACCCATTTTGAGGTGGG - Intergenic
909891718 1:81015840-81015862 CTGCCCACCCATATTGAAGGTGG - Intergenic
911978482 1:104534509-104534531 ATACCCACCCAGATTGAGGGTGG - Intergenic
913497186 1:119439113-119439135 CTTCAGACCAGGATTGAGGGAGG + Intergenic
917967361 1:180187062-180187084 CTGCAGACCCACACTGAGGAGGG - Intronic
919750051 1:201031913-201031935 ATACAGACCAAAATTGATGGGGG - Intergenic
923159638 1:231305174-231305196 CTACCTACCCATATTTAGGGAGG + Intergenic
1062849866 10:735769-735791 CTCCAGACCCGGATAGAGGGAGG + Intergenic
1062850002 10:736356-736378 CTCCAGACCCGGATAGAGGGAGG + Intergenic
1062850089 10:736730-736752 CTCCAGACCCGGATAGAGGGAGG + Intergenic
1062850113 10:736824-736846 CTCCAGACCCGGATAGAGGGAGG + Intergenic
1062850120 10:736847-736869 CTCCAGACCCGGATAGAGGGAGG + Intergenic
1062850297 10:737642-737664 CTACAGACCCGGATAGAGGGAGG + Intergenic
1062850311 10:737689-737711 CTCCAGACCCGGATAGAGGGAGG + Intergenic
1062850317 10:737712-737734 CTCCAGACCCAGACAGAGGGAGG + Intergenic
1062850344 10:737828-737850 CTCCAGACCCGGATAGAGGGAGG + Intergenic
1062850375 10:737967-737989 CTCCAGACCCGGATAGAGGGAGG + Intergenic
1062850382 10:737990-738012 CTCCAGACCCGGATAGAGGGAGG + Intergenic
1062850398 10:738059-738081 CTCCAGACCCGGATAGAGGGAGG + Intergenic
1062850411 10:738106-738128 CTCCAGACCCGGATAGAGGGAGG + Intergenic
1062850452 10:738268-738290 CTCCAGACCCGGATAGAGGGAGG + Intergenic
1062850530 10:738598-738620 CTCCAGACCCAGATAGAGTGCGG + Intergenic
1062850555 10:738715-738737 CTCCAGACCCAGATAGAGTGCGG + Intergenic
1064360849 10:14662925-14662947 GTACCCACCCAGATTGAGGGTGG - Intronic
1066277985 10:33887529-33887551 CTAGAGACCCAGACTGAGGTTGG - Intergenic
1067696213 10:48537402-48537424 CAACACACCCATAGTGAGGCTGG - Intronic
1071508770 10:86248353-86248375 CTACAGAACCAAATTGGGAGAGG + Intronic
1071846421 10:89525773-89525795 CTACAGACCCATGTGGAGTGGGG + Intronic
1074464415 10:113668734-113668756 GTGCCGACCCACATTGAGGGTGG + Intergenic
1077938670 11:6817089-6817111 CTGCTGACCCATTTTGATGGAGG - Intergenic
1082999967 11:59282355-59282377 CTGCCCACCCATATTAAGGGTGG - Intergenic
1084727873 11:70953677-70953699 GTGCCCACCCATATTGAGGGTGG + Intronic
1087286581 11:96270885-96270907 GTACCTACCCACATTGAGGGTGG - Intronic
1089646732 11:119885317-119885339 CTCCAGGCCCACAGTGAGGGAGG + Intergenic
1089807724 11:121106439-121106461 CTACAGACCCATATTGAGGGTGG - Intronic
1089894438 11:121914948-121914970 CTACAGAGCCATCTTTAGGGAGG + Intergenic
1094156015 12:27337546-27337568 CTCCAGACCCATCTAGAGGGAGG - Intronic
1096896736 12:54828542-54828564 GTACTCACCCACATTGAGGGTGG + Intergenic
1097589477 12:61556619-61556641 CAACAGACACTAATTGAGGGTGG - Intergenic
1098832377 12:75377690-75377712 GTACCTACCCACATTGAGGGTGG + Intronic
1098909808 12:76197370-76197392 CTACAGACCCATTTTCATAGTGG + Intergenic
1100715286 12:97299294-97299316 GTACCCACCCAGATTGAGGGTGG + Intergenic
1101562628 12:105873037-105873059 CCACAGACCCATATTGCATGGGG + Intergenic
1108472551 13:50782171-50782193 TTACAGACCCTTTGTGAGGGAGG - Intronic
1108924838 13:55728990-55729012 CGACAGAGAAATATTGAGGGTGG + Intergenic
1110980157 13:81887950-81887972 CAACATACCAATATTGAGCGAGG + Intergenic
1111438110 13:88239276-88239298 CAACAGACCCTTAAAGAGGGGGG - Intergenic
1114665816 14:24376600-24376622 CTAGTGACCCGTATGGAGGGCGG + Exonic
1115060861 14:29188057-29188079 GTACCCACCCACATTGAGGGTGG - Intergenic
1115474195 14:33798609-33798631 CTCCAGACCCAGCTTCAGGGAGG + Intronic
1116248693 14:42454528-42454550 GTACCCACCCAGATTGAGGGTGG - Intergenic
1116327382 14:43547808-43547830 GTACCCACCCAGATTGAGGGTGG + Intergenic
1117203271 14:53414192-53414214 CAACAGACCTATATTGAATGAGG - Intergenic
1120852811 14:89186522-89186544 CTACATAGCCATTTTGAGGGTGG + Intronic
1121873257 14:97428561-97428583 CTCCAGAACCATATAGAGGAAGG - Intergenic
1128792152 15:70441344-70441366 CTACAGCCCCATCTTGAGCATGG - Intergenic
1131947440 15:97641416-97641438 TGACAGACCCATATTGAATGGGG + Intergenic
1134504913 16:14797213-14797235 GTACCCACCCAGATTGAGGGTGG + Intronic
1134575661 16:15331696-15331718 GTACCCACCCAGATTGAGGGTGG - Intergenic
1134726786 16:16424806-16424828 GTACCCACCCAGATTGAGGGTGG + Intergenic
1134940648 16:18287057-18287079 GTACCCACCCAGATTGAGGGTGG - Intergenic
1139312327 16:66038070-66038092 CTGCCCACCCAGATTGAGGGTGG + Intergenic
1140764618 16:78145560-78145582 GTACCAACCCAAATTGAGGGTGG + Intronic
1140814481 16:78608593-78608615 CTGCAGACCCATACTGTGGAAGG + Intronic
1144851838 17:18247726-18247748 CTCCTGACCCAGCTTGAGGGCGG + Exonic
1153067803 18:1066298-1066320 GTGCATACCCATATTAAGGGTGG + Intergenic
1153101155 18:1471214-1471236 GTACCCACCCAGATTGAGGGTGG - Intergenic
1153613975 18:6917312-6917334 GTGCCCACCCATATTGAGGGTGG - Intergenic
1154035839 18:10800844-10800866 CTAGAGTCCCATATAGATGGAGG - Intronic
1155362782 18:25018510-25018532 CCACAGACCAAGGTTGAGGGTGG + Intergenic
1155618240 18:27746049-27746071 GTGCACACCCAGATTGAGGGTGG - Intergenic
1157064475 18:44331605-44331627 CTGCCCACCCACATTGAGGGTGG - Intergenic
1157540295 18:48497039-48497061 CAACAGAACCATATTCAGAGAGG + Intergenic
1158175870 18:54655026-54655048 CTGCCCACCCACATTGAGGGTGG + Intergenic
1163232630 19:16014995-16015017 CTGCAGACCCCTATTGACTGTGG - Intergenic
1165068505 19:33242048-33242070 ATACAGACCCAGACTGAGGACGG + Intergenic
1165124300 19:33583079-33583101 GTACCCACCCACATTGAGGGCGG + Intergenic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1166974030 19:46592994-46593016 GTACCCACCCAGATTGAGGGTGG + Intronic
926987221 2:18638347-18638369 GTGCCCACCCATATTGAGGGTGG - Intergenic
927294823 2:21441834-21441856 CTATAGCGCCATAATGAGGGTGG + Intergenic
928947183 2:36782033-36782055 GTCCAAACCCATTTTGAGGGTGG - Intronic
930173606 2:48278000-48278022 CAAGAGGCCCATATTAAGGGTGG - Intergenic
939227074 2:139377728-139377750 GTGCCCACCCATATTGAGGGTGG + Intergenic
942152977 2:173096694-173096716 CTACAGCCACATATTGAGAGTGG - Intronic
942175541 2:173330278-173330300 CTACAGACCAATATTCAAAGAGG - Intergenic
943568084 2:189540379-189540401 CTACAGTCCCATAAGGAAGGGGG + Intergenic
944336459 2:198540913-198540935 GTACTCACCCAGATTGAGGGTGG - Intronic
944424292 2:199563328-199563350 GTGCCCACCCATATTGAGGGTGG + Intergenic
945377811 2:209099612-209099634 GTACCCACCCAGATTGAGGGTGG + Intergenic
946124269 2:217547168-217547190 CTAAAAGCCCATATTGAGGGGGG + Intronic
1172313339 20:33934504-33934526 CTATCCACCCAGATTGAGGGTGG - Intergenic
1178106362 21:29323575-29323597 GTGCCCACCCATATTGAGGGTGG + Intronic
1179282825 21:39949692-39949714 GTACCCACCCAGATTGAGGGTGG - Intergenic
1181866570 22:25861929-25861951 CCACAGATACATATGGAGGGTGG - Intronic
1183128681 22:35811409-35811431 ATACAGACACATACAGAGGGAGG + Intronic
1184586827 22:45453574-45453596 CTAAAGAACCGTATTGAGGCCGG + Intergenic
951331699 3:21377257-21377279 GTACACACCCAGATTGAGGGTGG + Intergenic
958806599 3:98818623-98818645 GTGCCGACCCAGATTGAGGGTGG - Intronic
959154480 3:102649871-102649893 GTACCCACCCAGATTGAGGGTGG + Intergenic
959310182 3:104726162-104726184 GTGCCTACCCATATTGAGGGTGG + Intergenic
959339648 3:105112819-105112841 GTGCTCACCCATATTGAGGGTGG + Intergenic
960229366 3:115207254-115207276 CTACTGACCCATATTTAGGTGGG + Intergenic
963570484 3:146988780-146988802 GTACCCACCCAAATTGAGGGTGG - Intergenic
964389550 3:156183250-156183272 GTGCAGAGCCAAATTGAGGGAGG + Intronic
971540084 4:27804825-27804847 CTACAGTCCCACATTTTGGGAGG - Intergenic
972587477 4:40451010-40451032 CACCAGGCCCATGTTGAGGGAGG - Intronic
973319474 4:48795258-48795280 CTAGAGGCCCACATAGAGGGAGG + Intergenic
975161717 4:71132289-71132311 CTCCAGACACATGTTGACGGGGG + Intergenic
975720542 4:77244745-77244767 GTACCTACCCAGATTGAGGGTGG + Intronic
977553105 4:98463195-98463217 CTGCCTACCCAGATTGAGGGTGG - Intergenic
980678717 4:136126426-136126448 GTACCTACCCAGATTGAGGGTGG + Intergenic
981135553 4:141207074-141207096 GTACTCACCCACATTGAGGGTGG + Intronic
981464213 4:145048619-145048641 CCATGGACCTATATTGAGGGAGG - Intronic
985705381 5:1397696-1397718 CCACACACCAATAGTGAGGGAGG + Intronic
986040182 5:3986637-3986659 ATACCCACCCAGATTGAGGGTGG - Intergenic
989356691 5:40551486-40551508 GTACCCACCCAGATTGAGGGTGG - Intergenic
995265683 5:110156860-110156882 GTACCTACCCAGATTGAGGGTGG + Intergenic
995844345 5:116477890-116477912 CCAGAGACCCATATTGTGGATGG - Exonic
996909174 5:128635744-128635766 GTACCCACCCATACTGAGGGTGG + Intronic
1000598858 5:163248236-163248258 GTGCACACCCACATTGAGGGTGG - Intergenic
1004081786 6:12402078-12402100 CCCCAGAGGCATATTGAGGGAGG - Intergenic
1010095925 6:72045837-72045859 ACAAAGACCCAAATTGAGGGAGG - Intronic
1010325927 6:74561880-74561902 CTGCCCACCCACATTGAGGGTGG - Intergenic
1013623677 6:111916458-111916480 GTACCCACCCAGATTGAGGGTGG + Intergenic
1014860701 6:126464457-126464479 ATACCCACCCAGATTGAGGGTGG - Intergenic
1015570482 6:134616358-134616380 ACACAAACCCAAATTGAGGGAGG + Intergenic
1015870612 6:137772740-137772762 CCACAGACCCGCATTGGGGGAGG + Intergenic
1017050112 6:150383231-150383253 CTACAGTCTCATAGTAAGGGGGG - Intronic
1020742883 7:12043985-12044007 GTACCCACCCAGATTGAGGGTGG + Intergenic
1022505080 7:30904744-30904766 CTGCAGACTCATCCTGAGGGAGG + Intergenic
1023463704 7:40429688-40429710 GTGCACACCCAGATTGAGGGTGG + Intronic
1026480757 7:70777273-70777295 TTACAGACCCATAGTTAGGAAGG + Intronic
1027692844 7:81369876-81369898 GTGCTCACCCATATTGAGGGTGG - Intergenic
1028358767 7:89941662-89941684 TTAAAGACCTATATTAAGGGAGG + Intergenic
1033208689 7:139444165-139444187 GTACCTACCCATACTGAGGGTGG + Intergenic
1033575500 7:142679857-142679879 GTACCCACCCATATTGAGGGTGG - Intergenic
1034732530 7:153400462-153400484 CCACAGACCCATACTGGGGAAGG - Intergenic
1036491392 8:9229329-9229351 CTGCCCACCCAGATTGAGGGTGG + Intergenic
1039383887 8:37113437-37113459 GTACCCACCCAGATTGAGGGTGG + Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1041693296 8:60711396-60711418 CTACTGACTTATAATGAGGGTGG + Intronic
1042058703 8:64794047-64794069 GAACAGACCAATATTGAGTGAGG + Intronic
1042420538 8:68583141-68583163 CAAAAGAGCCATATTTAGGGTGG + Intronic
1042463989 8:69105254-69105276 CTACAAATCCTTTTTGAGGGAGG - Intergenic
1044330618 8:90915979-90916001 GTACCCACCCAGATTGAGGGTGG + Intronic
1050053194 9:1624390-1624412 GTACCCACCCACATTGAGGGTGG - Intergenic
1050933435 9:11361205-11361227 GTACCCACCCAGATTGAGGGTGG - Intergenic
1051176642 9:14367526-14367548 ATACACACCCATATTCATGGAGG - Intronic
1051792723 9:20826222-20826244 CTACACTCCCAGTTTGAGGGTGG - Intronic
1052174335 9:25439192-25439214 ATGCCCACCCATATTGAGGGTGG + Intergenic
1056789088 9:89613978-89614000 CAAGAGACCCACTTTGAGGGGGG - Intergenic
1058302533 9:103393863-103393885 GTACCCACCCAGATTGAGGGTGG + Intergenic
1058578234 9:106426136-106426158 CTAATGACCCCTATTGATGGAGG - Intergenic
1059985733 9:119818628-119818650 ATGCCCACCCATATTGAGGGTGG - Intergenic
1061216490 9:129224786-129224808 GTACAGACCCAGAATGAGGGGGG - Intergenic
1187524243 X:20039663-20039685 GTACCCACCCAGATTGAGGGTGG - Intronic
1192996479 X:76518089-76518111 CTGCCCACCCAGATTGAGGGTGG - Intergenic
1193688297 X:84606343-84606365 CTAGAAACCAATAATGAGGGAGG - Intergenic
1194230320 X:91314571-91314593 GTGCACACCCAGATTGAGGGTGG + Intergenic
1194343602 X:92733563-92733585 GTGCCCACCCATATTGAGGGTGG - Intergenic
1194366418 X:93019299-93019321 CTGCAGACCCAAGCTGAGGGTGG - Intergenic
1194823843 X:98537534-98537556 GTGCAGACCCAGATTGAGGGTGG - Intergenic
1197082557 X:122437587-122437609 GTACCCACCCACATTGAGGGTGG + Intergenic
1200651956 Y:5850226-5850248 GTGCCCACCCATATTGAGGGTGG - Intergenic
1200674645 Y:6135561-6135583 CTGCAGACCCAAGCTGAGGGTGG - Intergenic