ID: 1089809524

View in Genome Browser
Species Human (GRCh38)
Location 11:121120442-121120464
Sequence TCCCCACATCACCCTGGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 268}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089809524_1089809538 24 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809538 11:121120489-121120511 AGGAAGGAGCCTGAGATGCTGGG 0: 1
1: 1
2: 6
3: 40
4: 391
1089809524_1089809531 -9 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809531 11:121120456-121120478 ATGTGGGGACAGGCAGGGAGAGG 0: 1
1: 0
2: 13
3: 123
4: 1036
1089809524_1089809539 27 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809539 11:121120492-121120514 AAGGAGCCTGAGATGCTGGGAGG 0: 1
1: 0
2: 1
3: 42
4: 400
1089809524_1089809532 -8 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809532 11:121120457-121120479 TGTGGGGACAGGCAGGGAGAGGG 0: 1
1: 4
2: 21
3: 160
4: 1161
1089809524_1089809535 4 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809535 11:121120469-121120491 CAGGGAGAGGGCTGGGAAGCAGG 0: 1
1: 1
2: 15
3: 131
4: 1082
1089809524_1089809536 8 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809536 11:121120473-121120495 GAGAGGGCTGGGAAGCAGGAAGG 0: 1
1: 1
2: 14
3: 139
4: 1221
1089809524_1089809537 23 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809537 11:121120488-121120510 CAGGAAGGAGCCTGAGATGCTGG 0: 1
1: 0
2: 6
3: 126
4: 592
1089809524_1089809534 -3 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809534 11:121120462-121120484 GGACAGGCAGGGAGAGGGCTGGG 0: 1
1: 0
2: 8
3: 136
4: 1018
1089809524_1089809533 -4 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809533 11:121120461-121120483 GGGACAGGCAGGGAGAGGGCTGG 0: 1
1: 0
2: 31
3: 247
4: 1914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089809524 Original CRISPR TCCCCACATCACCCTGGGTC GGG (reversed) Intronic