ID: 1089809524

View in Genome Browser
Species Human (GRCh38)
Location 11:121120442-121120464
Sequence TCCCCACATCACCCTGGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 268}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089809524_1089809533 -4 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809533 11:121120461-121120483 GGGACAGGCAGGGAGAGGGCTGG 0: 1
1: 0
2: 31
3: 247
4: 1914
1089809524_1089809536 8 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809536 11:121120473-121120495 GAGAGGGCTGGGAAGCAGGAAGG 0: 1
1: 1
2: 14
3: 139
4: 1221
1089809524_1089809531 -9 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809531 11:121120456-121120478 ATGTGGGGACAGGCAGGGAGAGG 0: 1
1: 0
2: 13
3: 123
4: 1036
1089809524_1089809537 23 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809537 11:121120488-121120510 CAGGAAGGAGCCTGAGATGCTGG 0: 1
1: 0
2: 6
3: 126
4: 592
1089809524_1089809534 -3 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809534 11:121120462-121120484 GGACAGGCAGGGAGAGGGCTGGG 0: 1
1: 0
2: 8
3: 136
4: 1018
1089809524_1089809538 24 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809538 11:121120489-121120511 AGGAAGGAGCCTGAGATGCTGGG 0: 1
1: 1
2: 6
3: 40
4: 391
1089809524_1089809535 4 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809535 11:121120469-121120491 CAGGGAGAGGGCTGGGAAGCAGG 0: 1
1: 1
2: 15
3: 131
4: 1082
1089809524_1089809539 27 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809539 11:121120492-121120514 AAGGAGCCTGAGATGCTGGGAGG 0: 1
1: 0
2: 1
3: 42
4: 400
1089809524_1089809532 -8 Left 1089809524 11:121120442-121120464 CCCGACCCAGGGTGATGTGGGGA 0: 1
1: 0
2: 1
3: 32
4: 268
Right 1089809532 11:121120457-121120479 TGTGGGGACAGGCAGGGAGAGGG 0: 1
1: 4
2: 21
3: 160
4: 1161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089809524 Original CRISPR TCCCCACATCACCCTGGGTC GGG (reversed) Intronic
900847392 1:5114874-5114896 TCCCCTCCTCACCCCTGGTCCGG + Intergenic
901033864 1:6324604-6324626 TGCCCACACCCCCCGGGGTCTGG + Intronic
901648243 1:10728072-10728094 TCCCCACATGGCACTGGGTATGG + Intronic
902295593 1:15464732-15464754 TCCCCAGACAACCCTGGGGCAGG + Intronic
903666867 1:25013433-25013455 TCCTGACACCAGCCTGGGTCCGG + Intergenic
904036723 1:27562846-27562868 TCCCCACAACAGCCTGCGACGGG + Intronic
904688345 1:32275945-32275967 TCACCACCTCTCCCTGGTTCTGG - Exonic
906178833 1:43800450-43800472 TTCTGACATCACCCTGGGGCAGG + Intronic
906288582 1:44604363-44604385 TCCAGACATCTCCCTGGGTTGGG - Intronic
907411501 1:54286838-54286860 GCCCCACCTCACCCTGTGCCGGG + Intronic
910049310 1:82957061-82957083 TCCCCTCCTCACACTCGGTCCGG + Intergenic
911653618 1:100418110-100418132 TCCTCACATCACCCCGAGTTAGG - Intronic
912501276 1:110123758-110123780 TCCCCACATGAACCTGGGGAGGG - Intergenic
915898310 1:159828222-159828244 TCCACACATCACCCTGCCCCAGG - Intronic
916019219 1:160777868-160777890 CCCCCAAATCCTCCTGGGTCTGG - Intergenic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
916789740 1:168114962-168114984 TGCTCACATGACCCTAGGTCCGG + Intronic
917269171 1:173254677-173254699 TACCCCCATCACCCTTGATCTGG - Intergenic
917883869 1:179365052-179365074 ACCCAACATCCCCCTGAGTCTGG + Intergenic
919786669 1:201262476-201262498 TCCCCAAATCCCCCAGGGCCAGG + Intergenic
920283999 1:204866535-204866557 GCCCTACAGCACCCTGGGGCTGG + Intronic
920734323 1:208517040-208517062 TGCACACAGCACCCTGGGCCTGG + Intergenic
921212349 1:212911260-212911282 TCCCCTCATCACACCTGGTCCGG + Intergenic
923116382 1:230942789-230942811 TCCCCACCACACCATGGGACTGG + Intronic
924440142 1:244079121-244079143 TCCTCATATAACCCTGGGTGAGG + Intergenic
1062921761 10:1285557-1285579 TCCCCACTTAACCCTGGAGCTGG - Intronic
1064667717 10:17673892-17673914 TCCCCACATCAAGCTGTGCCTGG - Intronic
1066658972 10:37721104-37721126 TCCCCACAGGAGCCTGGCTCTGG - Intergenic
1069508602 10:69023265-69023287 CCCCCACACCATCCTGCGTCTGG + Intergenic
1069639264 10:69944293-69944315 TCCTCACAGCAGCCTGGGACAGG + Intronic
1070576850 10:77685945-77685967 TCTCCCCATCACCCTGCTTCCGG - Intergenic
1071494927 10:86161679-86161701 CAGCCACATCACCCTGGTTCTGG + Intronic
1072727315 10:97822442-97822464 TCCCGGCATCCCCCTGGGCCTGG - Intergenic
1073143640 10:101264970-101264992 TCCCCACTTCCCCTTGGCTCTGG - Intergenic
1073709551 10:106021586-106021608 TCCCCTCCTCACACCGGGTCCGG - Intergenic
1074740708 10:116482400-116482422 TCCCCTCCTCACACCGGGTCCGG + Intergenic
1075004141 10:118818465-118818487 TCCCCAGAACACCCTGGCGCAGG + Intergenic
1075538358 10:123290652-123290674 TTCCCTCATCTCCCTGGGCCTGG - Intergenic
1076217715 10:128710084-128710106 TCCCCAGACCACCCAGGGCCCGG + Intergenic
1076281123 10:129247154-129247176 TCCCCACTCCCCTCTGGGTCGGG + Intergenic
1076382750 10:130036513-130036535 TCCCCAGAACACCCTGGGCTGGG + Intergenic
1076995707 11:296579-296601 TGCCCACATCACCCTGGCTCTGG - Intergenic
1077038048 11:504612-504634 TTCCCACTCCCCCCTGGGTCGGG + Intronic
1077536592 11:3127600-3127622 TCCCCCCAGCACTCCGGGTCAGG - Intronic
1077589949 11:3483618-3483640 TCCCCTCCTTACACTGGGTCCGG - Intergenic
1078079801 11:8195681-8195703 TCTCCATTTCACCCTGTGTCTGG + Intergenic
1083269634 11:61565295-61565317 TGCCCAGATCACCCTGGAGCTGG - Intronic
1084276220 11:68052227-68052249 TCCCTAAACCACCCTGGGCCCGG - Intergenic
1084734218 11:71094038-71094060 TCCCCCCAGCACCCTGTGGCGGG - Intronic
1085016409 11:73177004-73177026 CCCCCACACCACCCTGCCTCAGG - Intergenic
1085415229 11:76315274-76315296 TCCCCACACCTCCCTGGGCAGGG + Intergenic
1089367152 11:117928002-117928024 TCGCCCCATCACCCTGTCTCAGG + Intronic
1089809524 11:121120442-121120464 TCCCCACATCACCCTGGGTCGGG - Intronic
1090107669 11:123869582-123869604 TCCCCTCCTCACACTCGGTCTGG - Intergenic
1092416246 12:8292523-8292545 TCCCCTCCTCACACTGGGTCCGG - Intergenic
1092490156 12:8937746-8937768 TTCCCAAACCACCCTGGGTTGGG - Intronic
1095953073 12:47791864-47791886 TCCTCACCTCACACTGGCTCCGG + Exonic
1097168104 12:57096438-57096460 TCCCCACCTACTCCTGGGTCAGG - Exonic
1097277727 12:57824530-57824552 TCCCAACCTCAACCTGGCTCAGG + Intronic
1097444667 12:59655187-59655209 TCCCCAGATCACCTTGTTTCAGG - Intronic
1101410077 12:104460187-104460209 TCTCCAGATCACCCTGGGAGAGG + Intronic
1103446664 12:120999440-120999462 CCCCCACATCCCCCGGGCTCAGG + Intronic
1106132727 13:26953113-26953135 TCCCCAGATCTCTCTAGGTCCGG - Intergenic
1108684432 13:52806546-52806568 TCCCCACATCAACCTAGGCCAGG + Intergenic
1109352843 13:61206516-61206538 TCCCCTCCTCACACCGGGTCCGG + Intergenic
1110768405 13:79306600-79306622 TTCTCACATCATCCTAGGTCAGG + Intergenic
1112144100 13:96678977-96678999 CCCCAACCTCACCCTGGGTGTGG + Intronic
1112278105 13:98039467-98039489 TGCCCACATTGCCCTGGCTCAGG + Intergenic
1112595643 13:100804704-100804726 TGCCCTCATCACCCAGGGCCAGG + Intergenic
1113396695 13:109954664-109954686 TCCCCAGATCCCCATGGGACAGG - Intergenic
1113736089 13:112679974-112679996 TCTCCTCATCACCCTGGGCCAGG + Intronic
1119477471 14:74939419-74939441 TCCCCTCCTCTCCCTGGATCTGG - Intergenic
1120539633 14:85736956-85736978 TCCCCTCCTCACACTCGGTCTGG - Intergenic
1121625685 14:95384103-95384125 TACCTACACCACCCTGGCTCAGG - Intergenic
1122710554 14:103653968-103653990 GCATCACATCACCCTGGGCCTGG + Intronic
1122771212 14:104098738-104098760 GTCCCACCTCCCCCTGGGTCTGG + Intronic
1123499243 15:20865747-20865769 GCCCCACACCACCCTGGGTGTGG - Intronic
1123556478 15:21439366-21439388 GCCCCACACCACCCTGGGTGTGG - Intronic
1123592719 15:21876712-21876734 GCCCCACACCACCCTGGGTGTGG - Intergenic
1123717111 15:23040826-23040848 TCCCCCCAGCACCCCTGGTCAGG - Intergenic
1124042534 15:26118541-26118563 TTCCCACATCACCCCAGGGCTGG - Intergenic
1125606940 15:40944801-40944823 TCCCCACTTGGCCCTGGGTTTGG + Intergenic
1126580539 15:50238626-50238648 TCCCCACACCTCCCTGAATCTGG + Intergenic
1128504203 15:68255087-68255109 TCCCCACATCAACCTAGCTTCGG - Intronic
1128742665 15:70095108-70095130 TCCTCACAACACCCTGGGGAAGG + Intronic
1129171446 15:73810557-73810579 TCCCCAGAGCACCCTGGCTCAGG - Intergenic
1130996873 15:88908937-88908959 TCCCCACATCTCCCTGAGGAGGG + Intronic
1131882584 15:96875788-96875810 TCCCCTCCTCACACCGGGTCTGG - Intergenic
1132061102 15:98693074-98693096 TCCCCACACAGCCCTGGGTTAGG - Intronic
1132390301 15:101433772-101433794 TCCCCACATCACCCTGAGCAAGG + Intronic
1202964820 15_KI270727v1_random:166555-166577 GCCCCACACCACCCTGGGTGTGG - Intergenic
1134136765 16:11681670-11681692 CCCCCTCATCACCCTGGCCCAGG + Intronic
1134402489 16:13922329-13922351 TCCCTACATCACCTTTGGTAGGG + Intronic
1135976314 16:27110751-27110773 TCCCCACACACCCCCGGGTCTGG - Intergenic
1136060745 16:27724590-27724612 TCCACACTCCACCCTGGGTGTGG - Intronic
1136418623 16:30118306-30118328 TCCCCTCCTCCCCCAGGGTCTGG - Intronic
1136552172 16:30987634-30987656 TCCCCACAGCAGCCTGGGAAAGG - Intronic
1136552532 16:30989302-30989324 CCCCCACCCCACCCTGGGCCAGG - Exonic
1137322806 16:47402526-47402548 TCCCCACAGCATCCCGGCTCTGG + Intronic
1142550132 17:732988-733010 TCCCCACATCTGCCTGCGGCTGG + Intronic
1142602208 17:1059179-1059201 GCCCCACGTCACCCAGGGCCAGG + Intronic
1142637054 17:1264265-1264287 TCCCCACACCGCCCTGGACCTGG + Intergenic
1142912046 17:3102695-3102717 TGCCCACCTCCCCCGGGGTCAGG + Intergenic
1143486684 17:7259148-7259170 TCCCCAGAGCACCCTGGGCCTGG + Intronic
1144220593 17:13096420-13096442 TCCCCACAGCACCGTAGATCTGG + Intergenic
1144639037 17:16927518-16927540 GTCCCACAGCAGCCTGGGTCTGG - Intergenic
1145118014 17:20229882-20229904 TGTTCACATCACCCAGGGTCAGG + Intronic
1145123045 17:20277948-20277970 TCCCCACCCCATCCTGGGTCAGG + Intronic
1145815073 17:27789455-27789477 TCCCCCCAACACCCCGGGTCTGG + Intronic
1147655565 17:42088681-42088703 TCCCCCCAACACCCAGGCTCTGG - Intergenic
1149439342 17:56661988-56662010 TCCCCTCACCACCCAGGGCCAGG + Intergenic
1150227784 17:63533250-63533272 TCCCCACATCTCCAAGGGTTTGG - Intronic
1152091901 17:78251883-78251905 TCTCCACATAGCCCTGGCTCCGG - Intergenic
1152140575 17:78534170-78534192 GCCCTAAATCACCCAGGGTCAGG + Intronic
1152805436 17:82353679-82353701 TCCCCCCATCACCCAGGGCCAGG - Intergenic
1153995284 18:10434775-10434797 TCCACACATTACCATGGGCCTGG + Intergenic
1154457286 18:14542501-14542523 GCCCCACACCACCCTGGGTGTGG - Intronic
1155173745 18:23285775-23285797 TCCCCTCCTCACACCGGGTCCGG + Intronic
1156616316 18:38789302-38789324 TCCCTAAATCACCATGGGACTGG - Intergenic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1159765023 18:72479097-72479119 TCCCAACATCACTCTTGGTAAGG - Intergenic
1161189406 19:2944791-2944813 GCCCCACCTCGCCCTGGGCCCGG + Intronic
1161533415 19:4804007-4804029 TCCCCTCCTCAGCCGGGGTCGGG + Intergenic
1162225598 19:9219102-9219124 TCCCCAGACCACTCTGGGTCTGG + Intergenic
1162225704 19:9220355-9220377 ACCCCAAACCACTCTGGGTCTGG + Intergenic
1164159679 19:22618119-22618141 TCCCCACTGCAGCGTGGGTCTGG + Intergenic
1165772082 19:38385854-38385876 TCCCCCGCTCACCCCGGGTCTGG - Exonic
1165838606 19:38773677-38773699 TCCCCCCATCACCCAGGGCCCGG + Intergenic
1165840956 19:38789020-38789042 TCCCCCCATCACCCAGAGCCCGG - Intergenic
1166383885 19:42369849-42369871 TCCACACATCTCCCTGGGACAGG - Intronic
1166732538 19:45067264-45067286 ACCGCACCCCACCCTGGGTCCGG - Intronic
1168098264 19:54127770-54127792 TCCCCATCTCACCCCTGGTCTGG + Intronic
1168721724 19:58558203-58558225 CTCCCACATCACCCTGCCTCAGG + Intronic
928169610 2:28994936-28994958 TCCCCACATCTCCCTTTTTCTGG - Intronic
928778234 2:34791454-34791476 TCCCCTCCTCACACCGGGTCCGG + Intergenic
928857093 2:35814806-35814828 TCCCCTCCTCACACCGGGTCCGG + Intergenic
931300514 2:60973877-60973899 TCCCCTCATCTCTTTGGGTCTGG - Intronic
933148604 2:78887838-78887860 TTACCACATCACCCTGGGAGAGG + Intergenic
933909551 2:86927818-86927840 TCCCCACATCCTTCGGGGTCTGG - Intronic
934023174 2:87975561-87975583 TCCCCACATCCTTCGGGGTCTGG + Intergenic
934678526 2:96266323-96266345 CCCCCACCTCCCCCTGCGTCGGG + Exonic
935332267 2:101985844-101985866 TACCCTCATCACCCCGGGCCAGG - Intergenic
936413381 2:112280844-112280866 TCCCCACATCCTTCAGGGTCTGG - Intronic
938942271 2:136179609-136179631 TCCCCAGGTGGCCCTGGGTCTGG + Intergenic
940876963 2:158907481-158907503 TACCCCCACCACCCTGGGACTGG - Intergenic
941748240 2:169109822-169109844 TCCCCGCAACACCCTGGCCCAGG + Intergenic
941935965 2:170981614-170981636 TCCCCTCCTCACACCGGGTCCGG - Intergenic
943460249 2:188164835-188164857 TCCCCTCATCACACCCGGTCTGG - Intergenic
946247827 2:218397465-218397487 TCCCCGCCTCCCCCTGGGTTGGG + Intergenic
948808556 2:240463340-240463362 TCCCCAGGTCCCCCTGGGCCCGG + Exonic
1168874436 20:1161088-1161110 TCCCCACGCCATCCTGCGTCTGG + Intronic
1169286393 20:4310975-4310997 TCCCCATGTCATCATGGGTCTGG + Intergenic
1173081900 20:39876389-39876411 TCCCCACATTACCCTGGTTATGG - Intergenic
1173207579 20:41006995-41007017 TCCCAACATCTCTCTGAGTCTGG + Intergenic
1173310152 20:41890102-41890124 TCTCCACACCCCACTGGGTCGGG + Intergenic
1173312873 20:41916255-41916277 TCACCTCCTCACCCTGTGTCTGG - Intergenic
1173725214 20:45292802-45292824 TCCCCAAATCACTCTAGGACTGG + Intergenic
1173733745 20:45345659-45345681 TCCCCACAACCGCCTGGGCCCGG + Intronic
1174200161 20:48801601-48801623 TCCCACCACCACCCTGGGCCAGG + Intronic
1174446573 20:50594915-50594937 TCCCCACAACAACCTGGGAGGGG + Intronic
1175190887 20:57211493-57211515 TACCCACAGCTTCCTGGGTCAGG - Intronic
1175895052 20:62332467-62332489 CCCCCACAGCACCCTGTGCCGGG - Exonic
1175923757 20:62462178-62462200 TCACCCCCTCACCCAGGGTCTGG + Intergenic
1176365354 21:6029577-6029599 TCCCCACATACCCCTGGGCCGGG + Intergenic
1176816873 21:13610852-13610874 GCCCCACACCACCCTGGGTGTGG + Intronic
1177589543 21:23144896-23144918 TCCACACAACAGCCTGGGTTTGG - Intergenic
1179758164 21:43508968-43508990 TCCCCACGTACCCCTGGGCCGGG - Intergenic
1179879589 21:44287797-44287819 CCCCCACTGCACCCTGGTTCTGG + Intronic
1181053224 22:20247395-20247417 TCCCCACACCACAGAGGGTCAGG + Intronic
1181055420 22:20258526-20258548 TCTCAACCTCACCCTGGGCCTGG + Intronic
1181546968 22:23607634-23607656 TCCACAGACCACCCAGGGTCTGG - Intergenic
1181679435 22:24483013-24483035 TCCACACATCCCTCTGGCTCAGG + Intergenic
1183172625 22:36199133-36199155 GCCCCCCAGAACCCTGGGTCAGG + Intronic
1183635749 22:39061477-39061499 TCCCCTCCTCACACCGGGTCTGG - Intronic
1184498837 22:44859908-44859930 TCCCCTCCTTGCCCTGGGTCTGG + Intronic
1185182145 22:49369710-49369732 ACCCCACTTCAGCCTGGGTGAGG + Intergenic
950263932 3:11561197-11561219 TCCCCACATTTGCGTGGGTCAGG - Intronic
950668093 3:14509338-14509360 CCTCCACCTCACCCTGGGACAGG + Intronic
953661551 3:44894713-44894735 TCTCCTCCTCCCCCTGGGTCTGG + Intronic
953982615 3:47420229-47420251 CCACCACATTGCCCTGGGTCGGG - Intronic
954288493 3:49636448-49636470 ACACCAGATCATCCTGGGTCGGG + Intronic
954734749 3:52697273-52697295 TCCCCAGATCACTCTGGGCCAGG + Intronic
954745186 3:52783812-52783834 CCCGGACATCCCCCTGGGTCAGG - Intronic
957307785 3:78480701-78480723 TCCCCACATCTGTCTGAGTCTGG - Intergenic
957653109 3:83035160-83035182 TCCCCAAATCTCACTGAGTCTGG + Intergenic
958843121 3:99232763-99232785 GCCCCACATCACCCTTGTACAGG - Intergenic
959414911 3:106072278-106072300 TCCCCAGATCACAGTGTGTCCGG - Intergenic
960175792 3:114516266-114516288 TCCCCACATAACCCATTGTCTGG + Intronic
961521397 3:127469176-127469198 TCCTCCCATGGCCCTGGGTCAGG - Intergenic
961880984 3:130061029-130061051 TCCCCTCCTCACCCCGGGTCCGG + Intergenic
961893784 3:130151120-130151142 TCCCCTCCTTACACTGGGTCTGG - Intergenic
962756740 3:138470614-138470636 TCCCCAAAGCCCCCTGGCTCTGG + Intronic
964380098 3:156089989-156090011 TCCTCACAACACTCTGGGGCAGG + Intronic
964530753 3:157665153-157665175 TCCCCACATCAGCCAGGTTAAGG - Intronic
964672450 3:159241508-159241530 TCACAGCATCACCCTGGCTCTGG + Intronic
964697459 3:159525622-159525644 TCTCCTCATCACGCTGTGTCTGG - Intronic
964984941 3:162726501-162726523 TCCCCTCCTCACACCGGGTCTGG - Intergenic
966397584 3:179518593-179518615 TCCCCTCTTCACACTCGGTCCGG + Intergenic
969485931 4:7472398-7472420 TCCCCTCATCCCCCTGAGGCGGG - Intronic
969748985 4:9095988-9096010 TCCCCTCCTCACACTGGGTCTGG + Intergenic
971330453 4:25677231-25677253 GCCCCAGATCAGCCTGGGTCAGG + Exonic
972843622 4:42960998-42961020 TCCCCACCTCACCCTCTGACAGG + Intronic
975810768 4:78166891-78166913 TCCCAGGATCACCCTGGGTGTGG - Intronic
977568405 4:98605903-98605925 TCCCCACACAACCCTGCCTCTGG + Intronic
982401483 4:154972590-154972612 TCCCCACTTCACACAGTGTCTGG - Intergenic
982497177 4:156107424-156107446 TCCCCTCCTCACACCGGGTCTGG - Intergenic
982808709 4:159799386-159799408 TCCCCACATCAGCCAGGTTTAGG - Intergenic
983885394 4:172975388-172975410 TCCCCACATCTGTCTGAGTCTGG + Intronic
984223051 4:177001707-177001729 TCCCTAGAAGACCCTGGGTCAGG - Intergenic
985540171 5:484094-484116 TCTCCACACCCTCCTGGGTCCGG - Intronic
985540193 5:484153-484175 TCTCCACACCCTCCTGGGTCCGG - Intronic
985540215 5:484212-484234 TCTCCACACCCTCCTGGGTCCGG - Intronic
985540237 5:484271-484293 TCTCCACACCCTCCTGGGTCCGG - Intronic
985540259 5:484330-484352 TCTCCACACCCTCCTGGGTCCGG - Intronic
985540281 5:484389-484411 TCTCCACACCCTCCTGGGTCCGG - Intronic
985540302 5:484448-484470 TCTCCACACCCTCCTGGGTCCGG - Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
986423967 5:7612428-7612450 TGCCCACCTCACCATGGTTCAGG - Intronic
989183789 5:38603590-38603612 TTCCCACATCACCCTTTGTCTGG - Intronic
990565195 5:57020974-57020996 TCCCCTCCTCACACTCGGTCTGG - Intergenic
992801528 5:80300271-80300293 CCCCCACACCATCCTGTGTCTGG - Intergenic
997622640 5:135308683-135308705 TCCCCACATTCCCCAGGGTTAGG - Intronic
998015101 5:138725488-138725510 TCCCCACATTCCCCTGTGCCAGG + Intronic
998387670 5:141767165-141767187 TCCCCGTACCACCCTGGGCCAGG - Intergenic
1000438515 5:161241695-161241717 TCCCCTCCTCACACTTGGTCCGG + Intergenic
1001588593 5:172850306-172850328 ACCCCACCCCACCCTGGGCCAGG + Intronic
1001932283 5:175681720-175681742 TCCCCACATCACCCTCTCACGGG - Intronic
1002701933 5:181130583-181130605 TCCCCTCTTCACCCCGTGTCTGG - Intergenic
1002703863 5:181147563-181147585 TCCCCTCCTCACCCCGTGTCTGG + Intergenic
1005024127 6:21446654-21446676 TCCCCACAACAACCTGGGAAGGG - Intergenic
1005886965 6:30104289-30104311 TCCACACTTCCCCCTGGGTGGGG - Intronic
1007486669 6:42185239-42185261 TCCCCACATAGCCCTGAGGCTGG + Intronic
1007760238 6:44128740-44128762 TCCCCACCTCACCCTGGCCTGGG - Intronic
1010761797 6:79732656-79732678 TGCCCTAATCACCCAGGGTCAGG + Intergenic
1011527018 6:88276474-88276496 TCCCCACGCCATCCTGCGTCTGG - Intergenic
1014490279 6:122053916-122053938 TCCTCACATCACCCCGACTCGGG - Intergenic
1016388089 6:143548539-143548561 TCCACACACCAGCCTGGGCCAGG + Intronic
1016519977 6:144936178-144936200 TCCCCTCCTCACCCTAGGTTAGG - Intergenic
1018962587 6:168459061-168459083 TCCCCACAACACCCTCGATGTGG + Intronic
1019052657 6:169195076-169195098 CTCCCACCTCTCCCTGGGTCTGG + Intergenic
1019285243 7:220018-220040 CCCGCTCCTCACCCTGGGTCTGG + Intronic
1019336417 7:485035-485057 GCCCCCCATGACCCTGGGACTGG + Intergenic
1019388302 7:770851-770873 CCCCCACAGCACTCTGGGTGAGG + Intronic
1019486927 7:1293642-1293664 TCCCCGCAGCCCCCAGGGTCCGG - Intergenic
1019537551 7:1537192-1537214 CCCACACGTCACCGTGGGTCTGG + Intronic
1019571682 7:1715793-1715815 TTCCCTCCTCCCCCTGGGTCAGG + Intronic
1019623736 7:2004879-2004901 TCCTCACATGACCCAGGGCCTGG + Intronic
1019812067 7:3172102-3172124 TCCCCACTTCTCCCTGCCTCCGG - Intronic
1020144281 7:5630802-5630824 TCACCACAGCTCCCTGAGTCAGG + Intronic
1020324014 7:6960652-6960674 TCCCCTCCTCACACTGGATCTGG - Intergenic
1021807938 7:24375348-24375370 TGCTCTCATCACCCAGGGTCAGG + Intergenic
1022514816 7:30968920-30968942 GCCCAACACCACCCTGGGTATGG + Exonic
1022648075 7:32250202-32250224 TCCTCACATCCCCCTGCCTCTGG + Intronic
1023043910 7:36195288-36195310 TGCCCCCAGCACACTGGGTCAGG - Intronic
1023264033 7:38386889-38386911 GCCCCACATCACACTGAGTGAGG - Intronic
1029187062 7:98746876-98746898 TCCCCACTGGACCCTGGGGCAGG + Intergenic
1033979489 7:147146381-147146403 TCCCCACGGACCCCTGGGTCAGG - Intronic
1035375003 7:158401980-158402002 TTCCCACCTCTCCCTGGCTCTGG - Intronic
1035627673 8:1084531-1084553 TCCCCACATCCCCCAGCCTCGGG + Intergenic
1036372060 8:8170333-8170355 TCCCCTCCTCACACTGGGTCTGG + Intergenic
1036878840 8:12495308-12495330 TCCCCTCCTCACACTGGGTCTGG - Intergenic
1037516761 8:19639522-19639544 TACCCCCATCACTCTTGGTCAGG + Intronic
1037730973 8:21523892-21523914 TCCACACATCTCCCAGGGGCTGG - Intergenic
1037882527 8:22579945-22579967 TCCCCACCTCCCCCAGGGGCCGG - Intronic
1039453281 8:37692762-37692784 TCCCCACAGCAGCCTGGTTCTGG + Intergenic
1039800469 8:40950245-40950267 GCCCCCCATCTCCCTGGGCCAGG + Intergenic
1040280518 8:46039624-46039646 TCCCCACACCCCACTGGGGCTGG - Intergenic
1041851212 8:62395213-62395235 TCCCCGCACCTCCCTCGGTCTGG - Intronic
1045468358 8:102489489-102489511 ACTCCCCCTCACCCTGGGTCAGG + Intergenic
1047207509 8:122814892-122814914 TCCCTACCTCATCCTAGGTCTGG + Intronic
1048143699 8:131820908-131820930 TCCCCTCCTCACACTTGGTCTGG + Intergenic
1048311342 8:133324650-133324672 TCCCCACAGTAGCCTGGCTCTGG - Intergenic
1049403579 8:142441775-142441797 TCCCCACAACATCCTGGCTGAGG - Intergenic
1049762426 8:144337318-144337340 TCCCCACAAGACCCCGAGTCCGG - Intergenic
1050140398 9:2511141-2511163 TCCCCACCTCACACCTGGTCCGG + Intergenic
1052029474 9:23611798-23611820 ACCCCACATCCCCCTGAGCCAGG + Intergenic
1053463354 9:38287735-38287757 TGCCCACATCACCCTGCTTGAGG + Intergenic
1053470589 9:38343524-38343546 TCCCCAGAGCACTCTGGGGCTGG + Intergenic
1057277899 9:93685979-93686001 TCTCCACTTCACTCTGGGGCGGG + Intergenic
1057280062 9:93702554-93702576 TCCCTGCATCTCTCTGGGTCTGG - Intergenic
1057726564 9:97572440-97572462 TCCCCACAGCCCCCTGGTCCTGG - Intronic
1060068351 9:120524925-120524947 TCCTCACCTCACCAGGGGTCAGG + Intronic
1060148669 9:121272483-121272505 TCCCCACATGTACTTGGGTCCGG + Intronic
1060295302 9:122339149-122339171 TCTCCTCATCTCCCTGGGTCTGG + Intergenic
1060544228 9:124450972-124450994 ACCCCAGATCACCCAGGGTTAGG + Intergenic
1060759590 9:126236058-126236080 TCCCGCCACCACCCTGCGTCTGG + Intergenic
1060990528 9:127846394-127846416 TCCCAACATGACCCAGTGTCTGG + Intronic
1062249841 9:135588543-135588565 TCCCCACCCCACCATGGCTCTGG - Intergenic
1062423293 9:136494291-136494313 TCCCCACACCCCCGTGGGCCAGG + Intergenic
1203530488 Un_GL000213v1:138642-138664 GCACCACACCACCCTGGGTGTGG - Intergenic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1187484760 X:19693097-19693119 GCCCCACATCCCCATGGGACTGG + Intronic
1189630598 X:42948572-42948594 CCCCAATATCACCCTGGCTCAGG + Intergenic
1190199401 X:48347286-48347308 ACCCCACAGCATCCTGGGTAGGG + Intronic
1190666168 X:52697768-52697790 ACCCCACAGCATCCTGGGTAGGG + Intronic
1190673250 X:52760642-52760664 ACCCCACAGCATCCTGGGTAGGG - Intronic
1191014272 X:55792271-55792293 TCCCCTCCTCACACTCGGTCTGG - Intergenic
1191641331 X:63431808-63431830 TCCCCACAACACCCTTGTCCTGG - Intergenic
1196869879 X:120102639-120102661 CCACCACAACACCCTGGGTTTGG + Intergenic
1197706954 X:129641024-129641046 TCCCTACAGGTCCCTGGGTCAGG + Intergenic
1198237444 X:134748505-134748527 TCCCCACATCACCAATGGTAAGG + Intronic
1200166323 X:154038164-154038186 TGCCCAGGTCACCCTGGGACTGG - Intronic