ID: 1089810354

View in Genome Browser
Species Human (GRCh38)
Location 11:121126336-121126358
Sequence CCTCATCTGCAGCAGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 439}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089810354_1089810360 26 Left 1089810354 11:121126336-121126358 CCCTGCTGCTGCTGCAGATGAGG 0: 1
1: 0
2: 3
3: 29
4: 439
Right 1089810360 11:121126385-121126407 TTTTTCTTAAATATTAGGAGTGG 0: 1
1: 0
2: 2
3: 59
4: 604
1089810354_1089810357 21 Left 1089810354 11:121126336-121126358 CCCTGCTGCTGCTGCAGATGAGG 0: 1
1: 0
2: 3
3: 29
4: 439
Right 1089810357 11:121126380-121126402 AGCCCTTTTTCTTAAATATTAGG 0: 1
1: 0
2: 0
3: 27
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089810354 Original CRISPR CCTCATCTGCAGCAGCAGCA GGG (reversed) Intronic
900688425 1:3964493-3964515 TCTTGTCTGCAGCAGCTGCACGG - Intergenic
901880991 1:12193652-12193674 GCTCATCAGAAACAGCAGCAAGG - Intronic
902398734 1:16146039-16146061 CATCACTTCCAGCAGCAGCATGG + Intronic
902790233 1:18762730-18762752 CCTCATCTGTGGCTTCAGCAAGG + Intergenic
902925698 1:19694461-19694483 CCTCCTGTCCTGCAGCAGCACGG + Exonic
903057385 1:20645619-20645641 CAGCAGCTGCAGCAGCATCATGG - Exonic
903570064 1:24297729-24297751 CCTCCTCCGAAGCAGCAGCAGGG - Intergenic
903808915 1:26023546-26023568 CCTCAGCTGCAGCAGCAGGAGGG + Intronic
904028862 1:27521553-27521575 CATCAGCAGCAGCAGCAGCAGGG - Intergenic
904418155 1:30375292-30375314 CCTCATCTCCAGCCCCATCAGGG + Intergenic
904921566 1:34012188-34012210 CCTGATCTGCTGGAGGAGCAAGG - Intronic
905172907 1:36119531-36119553 CCCCTCCTGCAGCGGCAGCAGGG - Intronic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906680762 1:47724175-47724197 TGTCACCAGCAGCAGCAGCAGGG + Intergenic
907933700 1:59022996-59023018 CCTCTTATGCTGCAGCAGAAGGG - Intergenic
907934851 1:59032949-59032971 CCTCCTCTGCATCATCACCAAGG + Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
909024574 1:70467917-70467939 CCTCTTCTGCAGCTCCAGCCTGG + Intergenic
909039412 1:70631071-70631093 CCACATGTACAGCATCAGCAGGG - Intergenic
909466575 1:75980128-75980150 CCTCATCAGCAGCTGCTGCTTGG - Intergenic
910037485 1:82805383-82805405 CCTCAACTGCAGCCTAAGCATGG + Intergenic
910342784 1:86207388-86207410 CCTCATCCCCAGAAGCTGCAGGG + Intergenic
910662049 1:89684372-89684394 CCTAATCAGCTGCAGCGGCAGGG - Intronic
912332780 1:108834766-108834788 CCTCACCTGCCCCACCAGCAGGG - Intronic
912747040 1:112253556-112253578 CTTCATCTGCAGCTGCTGCTGGG - Intergenic
915034572 1:152911118-152911140 AAGCATCTGGAGCAGCAGCAGGG + Exonic
915064150 1:153210753-153210775 CCTCACCTCGGGCAGCAGCAAGG + Intergenic
915165870 1:153947444-153947466 CCCCATCTGATGCTGCAGCAGGG + Intergenic
919306914 1:195853224-195853246 CCTCAGCAGCAATAGCAGCAAGG - Intergenic
919685723 1:200481970-200481992 CATCATCTGGAGCAGTATCATGG - Intergenic
919787424 1:201268702-201268724 CCTCAGCAGCAGCTGCTGCAGGG + Intergenic
919927268 1:202198782-202198804 CCTCATCTGTAGCCCCTGCAGGG - Intronic
920347282 1:205314349-205314371 CATCCCCTGCAGCTGCAGCATGG - Intronic
920362037 1:205425575-205425597 CCTCATCTGCAGCCTTAGCAGGG - Intronic
921266587 1:213425822-213425844 CCACCGCAGCAGCAGCAGCAGGG - Intergenic
921407755 1:214799597-214799619 CTGCATCTGCAGCAGTAGAAGGG + Intergenic
922233558 1:223706358-223706380 TCTCTTCTGAAGCAGCTGCAGGG - Intronic
923543259 1:234904544-234904566 TCCCATTTCCAGCAGCAGCAAGG - Intergenic
924196916 1:241617606-241617628 CTCCATTTGCATCAGCAGCAGGG - Intronic
924483899 1:244461449-244461471 GCTCAGCCACAGCAGCAGCACGG - Exonic
924624259 1:245686673-245686695 CATCATCAGCAGCATCAGCGAGG + Exonic
924672946 1:246147751-246147773 CCAGGTCTGCAGCCGCAGCAGGG - Intronic
1063946397 10:11180399-11180421 CCTCATCTGCAGGATGAACAGGG + Intronic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1064437305 10:15322468-15322490 CCTGAACTGTAGCAGCAGCTAGG + Intronic
1064628441 10:17285108-17285130 CCTCATCTACAGCATAGGCAGGG + Intergenic
1064891010 10:20173511-20173533 CCTGATCAGCATCAGCAGGAGGG - Intronic
1064923698 10:20547169-20547191 CTTCATGTGCAGCAGAACCATGG - Intergenic
1064983199 10:21184598-21184620 CCCTAGCAGCAGCAGCAGCAGGG - Intergenic
1067056543 10:43055946-43055968 CCTATTATGAAGCAGCAGCAGGG + Intergenic
1067432548 10:46253507-46253529 CCTCCCCTTCAGCAGCAGGAGGG + Intergenic
1067434818 10:46269456-46269478 TGTCATCTGCAGGAGAAGCAAGG + Intergenic
1067440711 10:46307940-46307962 CCTCCCCTTCAGCAGCAGGAGGG - Intronic
1067555022 10:47263367-47263389 CCTAATCAGCACCAGCTGCAAGG + Intergenic
1067738384 10:48877016-48877038 GTTCATCTGCAGCAGCATAAAGG - Exonic
1069639920 10:69948051-69948073 TCTCATCTGCTGCTGCATCATGG + Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070835762 10:79445892-79445914 GCTCATCTGCATATGCAGCACGG + Intergenic
1071370269 10:84944156-84944178 CCCCACCATCAGCAGCAGCATGG - Intergenic
1071869874 10:89781822-89781844 CCGCACCCCCAGCAGCAGCATGG - Intergenic
1072546785 10:96446209-96446231 CCTTCTCTGCATCAGCACCAAGG + Intronic
1074050580 10:109877737-109877759 GCTCCTGTGCAGAAGCAGCAAGG + Intronic
1074331252 10:112511869-112511891 TGTCATCTGCAGCAACAGGATGG - Intronic
1074415246 10:113261814-113261836 ACTCATCTGCAGAAGTCGCAAGG - Intergenic
1074493017 10:113955754-113955776 CCACATCTGCGGGAGCAGGAAGG - Intergenic
1074601366 10:114917164-114917186 CCTCATTTCCAGCAGGAGGAAGG + Intergenic
1075200254 10:120396384-120396406 CTTCACCAGCAGCAGCAGCATGG - Intergenic
1075486884 10:122829650-122829672 AAGCAGCTGCAGCAGCAGCAGGG - Intergenic
1076681728 10:132175703-132175725 CATCATCTCCAGCAGCAGCATGG - Intronic
1076853220 10:133103142-133103164 CCACATCTGCAGCTGGAGCCCGG + Intronic
1077143769 11:1035953-1035975 GGTCACCTGCAGCAGCCGCAGGG + Intronic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078351101 11:10594187-10594209 CCCCATCTTCTGCAGCAGGAGGG + Exonic
1078514307 11:12009234-12009256 CCGCATCTGCACCCGCAGCCCGG - Intronic
1080576830 11:33607469-33607491 CTTCATCTTCAGCAGCAGAATGG + Intronic
1080645094 11:34182389-34182411 CCTCATCTCCTCCAGCAGCCAGG + Intronic
1081909601 11:46692415-46692437 TCACATCTGCACCAGCAGCAAGG + Intronic
1082026947 11:47579284-47579306 CCTCACCGGCAGCAACAGAACGG - Exonic
1083176104 11:60951420-60951442 CAGCATCTCCACCAGCAGCACGG + Exonic
1083253858 11:61484760-61484782 CCTCTGCTCCACCAGCAGCAGGG + Exonic
1083363906 11:62129902-62129924 CGGCAGCTGCAGCCGCAGCACGG - Exonic
1083669393 11:64291757-64291779 CCTCAGCCGCAGCCGCAGCGGGG + Intronic
1083684849 11:64369947-64369969 CCTGATGTGCAGCAGCACGAGGG + Intronic
1083871279 11:65489899-65489921 CCTGAACAGCAGCAGCAGCTGGG + Intergenic
1085314316 11:75535167-75535189 CCTTATCTCCAGGAGCAGCAGGG + Intergenic
1085314879 11:75538735-75538757 CCTTACCAGTAGCAGCAGCAGGG - Intergenic
1085507428 11:77068249-77068271 CCTGGCCTGCAGCAGCAGCTGGG - Intronic
1089493926 11:118899205-118899227 CCTCGGCTGCAGCAGCCCCATGG - Exonic
1089810354 11:121126336-121126358 CCTCATCTGCAGCAGCAGCAGGG - Intronic
1090125109 11:124076291-124076313 TCTCATCTGCAGCAACTGCTGGG - Intergenic
1091071672 11:132570433-132570455 CCTCATCTTCAGGAGCAGGCAGG + Intronic
1091812336 12:3409833-3409855 CCTCATCAGCTTCAGCACCAGGG + Intronic
1093098651 12:15000976-15000998 CATAATCTGCAGCTGCTGCATGG + Intergenic
1096574991 12:52547206-52547228 CCTCATCTGTAACAACAGCGAGG + Intronic
1098147872 12:67516251-67516273 CCTCAGCTGCAGCACCTGCTAGG + Intergenic
1098166679 12:67705631-67705653 CCACATCTGCTCCAGCAGCCTGG + Intergenic
1100201454 12:92302819-92302841 CATCATCTCTAGAAGCAGCATGG - Intergenic
1101211464 12:102539117-102539139 TTTCAGCAGCAGCAGCAGCAGGG + Intergenic
1102417534 12:112777250-112777272 TCACAACAGCAGCAGCAGCAAGG - Intronic
1102901969 12:116646027-116646049 CCCCAGCTCCAGCATCAGCAAGG - Intergenic
1104301033 12:127565210-127565232 CCTCATCTGCAGAACCTTCAGGG + Intergenic
1104736554 12:131139004-131139026 CCTCATCTCCCCCAGGAGCATGG + Intronic
1104769139 12:131349842-131349864 GCTCAACTGCAGAAGCATCAGGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1108596572 13:51954983-51955005 ACTAAGCAGCAGCAGCAGCAAGG + Intronic
1111397099 13:87677819-87677841 CCGCAGCTGCAGCTGCAGCCCGG + Exonic
1111452850 13:88441545-88441567 CCTTATCTCCTGCAGCTGCAGGG + Intergenic
1111989877 13:95105793-95105815 CATCATCTGCATCAGCATCTTGG - Intronic
1112438527 13:99408567-99408589 CATCGTCTGCAGCAGCACCAAGG + Intergenic
1113096862 13:106674616-106674638 GTTCATTTGCAGCAGCAGAAGGG - Intergenic
1113591511 13:111504619-111504641 CCACAGATGCAGCAGCACCACGG - Intergenic
1114187950 14:20417406-20417428 CCTCAGCTCCAGAAGTAGCAAGG - Intergenic
1114263631 14:21057921-21057943 CCCCAGAAGCAGCAGCAGCAGGG - Exonic
1114569726 14:23658163-23658185 CCACATCTCCAGTCGCAGCACGG + Intergenic
1115204371 14:30886287-30886309 CATCATGTGCAGCAGCTGCAGGG - Exonic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1117404061 14:55384854-55384876 GCTGATCAGCAGCAGCATCAGGG + Intronic
1118711356 14:68522230-68522252 CCTCCTTTCCAGCAGCAGAAAGG - Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119749121 14:77065066-77065088 CCTCATGTGGACCCGCAGCAGGG - Intergenic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1122441283 14:101733923-101733945 GCTCAGCTTCAGGAGCAGCAAGG - Intergenic
1122549679 14:102543310-102543332 ACTCCTCTGCAGGAGCAGCCTGG + Intergenic
1123146224 14:106133185-106133207 ACTCCTCTGCAGCAGCTCCAGGG + Intergenic
1123186464 14:106522234-106522256 ACTCCTCTGCAGCAGCTCCAGGG + Intergenic
1123205257 14:106706627-106706649 CCTCCTGTGCACCAGCTGCAGGG + Intergenic
1123210302 14:106753894-106753916 CCTCCTGTGCACCAGCTGCAGGG + Intergenic
1202943079 14_KI270726v1_random:1267-1289 ACTCCTCTGCAGCAGCTCCAGGG - Intergenic
1123766503 15:23483909-23483931 TCTCATCTGCAGTAGCTACAGGG - Intergenic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1127966964 15:63929726-63929748 CCTGCTCTTCAGCAGCAGCCCGG + Intronic
1128519834 15:68368015-68368037 CCACATCTGCATCAGCACCATGG - Intronic
1128768868 15:70267142-70267164 CCACATCATCAGCAGCAGCCTGG + Intergenic
1129275497 15:74442722-74442744 CCTCAACTGGAGCTGCTGCAGGG - Intergenic
1129331951 15:74832338-74832360 CCTCCGCAGCATCAGCAGCAAGG + Intergenic
1129538952 15:76335996-76336018 CAGCAGCGGCAGCAGCAGCAAGG + Intergenic
1130956255 15:88629398-88629420 CTTCTTGTGCAGCAGCTGCAGGG - Exonic
1131375048 15:91916304-91916326 CCTCATCTGCCGCAACCGGACGG + Exonic
1131504902 15:93008868-93008890 CCTCATCTGCAAGAGAGGCATGG - Intronic
1132004270 15:98212629-98212651 TCTCTTCTGCAGAAGCTGCAAGG + Intergenic
1132252124 15:100341840-100341862 CCAAACCAGCAGCAGCAGCACGG + Exonic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1132564180 16:613189-613211 CCTCACCTGTAGAATCAGCAGGG + Intronic
1133065279 16:3201983-3202005 CCTCCTCTGCAGGAGCAGTCAGG + Intergenic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133845491 16:9449667-9449689 CAGTAGCTGCAGCAGCAGCAGGG + Intergenic
1134235599 16:12463074-12463096 CAGCATGGGCAGCAGCAGCAGGG - Intronic
1135424239 16:22324441-22324463 CCTCCCCTCCAGCAGCAGCCTGG - Intronic
1135673486 16:24394425-24394447 CTGCATATTCAGCAGCAGCAGGG - Intergenic
1136551921 16:30986469-30986491 CCTGGTCTACACCAGCAGCATGG + Exonic
1136622153 16:31436398-31436420 CCGCAGCTGCAGCAGCAGAAGGG + Exonic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137723160 16:50639596-50639618 CCTCATCCTCTGCTGCAGCATGG - Exonic
1138157856 16:54722494-54722516 CCTCCTCTGCAGCCACAGGAGGG - Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139590102 16:67928631-67928653 CCTCCTCTGCAGCTGCACGAAGG + Exonic
1139630304 16:68227701-68227723 TCTCACCAGCAGCAGCACCAGGG - Exonic
1139657575 16:68398114-68398136 CCACAGCTGCAGCTCCAGCAGGG - Intronic
1139749878 16:69103296-69103318 CCTCATCTGCAGCAACTCCAGGG + Intergenic
1139796980 16:69491073-69491095 CCTCAGCTGTGGCATCAGCAGGG + Intergenic
1140756781 16:78074741-78074763 CCTCACCTGAAGCAGGAGAAGGG + Intergenic
1141618386 16:85222821-85222843 CCTCCTCTGCAGCAGAAGTTTGG + Intergenic
1142185089 16:88691090-88691112 CCTCATCTGCCGCAGGCCCAAGG - Intergenic
1143862964 17:9904717-9904739 CCTCTGCAGCAGCTGCAGCAGGG + Intronic
1144433126 17:15213448-15213470 CTTCATCTGAAGCAGCATGATGG + Intergenic
1144678292 17:17175722-17175744 CCTGAGCTGCAGCAGCCACATGG - Intronic
1144891046 17:18494563-18494585 CCTCAGCCGCAGCAGCACCTGGG + Exonic
1145141177 17:20449755-20449777 CCTCAGCCGCAGCAGCACCTGGG - Intronic
1145303609 17:21657105-21657127 CCGCATCTCCAGCAGCACCGCGG - Intergenic
1145346434 17:22044744-22044766 CCGCATCTCCAGCAGCACCGCGG + Intergenic
1145794746 17:27649178-27649200 CCTCAGCCGCAGCAGCACCTGGG + Exonic
1146264769 17:31445118-31445140 CACCATCTGCAGCAGGAGCTTGG - Intronic
1146675859 17:34773431-34773453 GCCCAACTGCAGCAGCAGGAGGG + Intergenic
1146821694 17:35987984-35988006 CCTCATCTGAATCATCAGGATGG + Intronic
1147362442 17:39939817-39939839 CCACATCTGCAGCTCCAGCTGGG + Intergenic
1147661198 17:42117964-42117986 CCCCATCTTCAGCCCCAGCATGG - Exonic
1148675451 17:49442250-49442272 CCTCATCTCCGGCAGCAGAGTGG + Intronic
1148733253 17:49850646-49850668 CCCCATCTGCATCAGGAGAATGG - Intergenic
1149015253 17:51901493-51901515 CAGCAACTGCAGCAGCATCATGG + Intronic
1149188485 17:54030355-54030377 CCTCATCTCAAGCAGAAGGAAGG - Intergenic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1152461496 17:80444602-80444624 CCTCCCCTGCCGCAGGAGCAGGG - Intergenic
1152587823 17:81196933-81196955 CGCTCTCTGCAGCAGCAGCATGG + Exonic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152877257 17:82793933-82793955 CCTCATCTGCAGAGTCGGCATGG + Intronic
1152929170 17:83101202-83101224 CCTGAGCTGCAGCTGCAGCGAGG - Intergenic
1153140946 18:1971954-1971976 TGGCATCTGCAGCTGCAGCATGG - Intergenic
1153332689 18:3890022-3890044 GGTCATCTGCAGCAGAACCAAGG + Intronic
1153580597 18:6569835-6569857 CCTAATCTGCAGTTGCAGGAAGG + Intronic
1154049026 18:10935771-10935793 TCTCATCTGCAGCATGACCACGG + Intronic
1157299236 18:46467735-46467757 CTTCACCTGCAGCCTCAGCATGG + Intergenic
1158111494 18:53944774-53944796 CCCCATGTACAGCATCAGCAGGG + Intergenic
1158920589 18:62187295-62187317 CCTCTGCTGCACCAGCAGCCCGG - Exonic
1159037616 18:63292910-63292932 CATCACCTGCAGCAGCAGGAAGG - Intronic
1161000724 19:1909494-1909516 CCTCACCTGTGCCAGCAGCAGGG + Intronic
1161074011 19:2276235-2276257 GCTCAGCTGCAGCAGCAGCAGGG + Exonic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1161780069 19:6286063-6286085 CCTAATCTGCAGCTGCAGTTTGG - Intergenic
1162467403 19:10850446-10850468 CCTGAGCGGCGGCAGCAGCAAGG + Exonic
1162531400 19:11238255-11238277 CCTCAACTTCAGCAGCCGCCAGG - Exonic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1163508533 19:17721966-17721988 CTTCCTCTCCAGCAGCAGCCGGG - Intronic
1163592534 19:18202641-18202663 CATCATCGGCAACAGCAGCGTGG - Exonic
1164161430 19:22627825-22627847 TCTCAGCAGCAGCAGCAGCTTGG + Intergenic
1165020126 19:32917401-32917423 CTGCAACTGCAGCAACAGCAGGG + Intronic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1167288926 19:48614193-48614215 CCTCCACTGCAGCAGCTGGAAGG - Intronic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1168094893 19:54108869-54108891 CCTCCTCTGCACCAGCACCTGGG + Intronic
925077601 2:1030829-1030851 GCTCTTCTGCAGCAGAACCATGG - Intronic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
925587323 2:5476423-5476445 CCGAATCATCAGCAGCAGCATGG - Intergenic
926601915 2:14854582-14854604 CCTCACCCCCAGCAACAGCATGG + Intergenic
927181001 2:20446850-20446872 CCGCAGCGGCAGCAGCAGCGCGG + Intergenic
928071684 2:28223428-28223450 CCTGAGCTGCATCAGCAGAATGG + Intronic
928198284 2:29230393-29230415 CATCATCTGCTGCAGCAGAAAGG - Intronic
928472147 2:31585393-31585415 CCTCTTCTCAAGCAGCAGGAAGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929620773 2:43351725-43351747 CTGCATTTGCAGCAGCAGCTGGG + Intronic
929670250 2:43871746-43871768 CCACATCTGCAGAAGCCTCAGGG - Intronic
930799032 2:55423094-55423116 CCACAAATGCAGCAGCAGAATGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932188784 2:69721117-69721139 CCACATGTGAAGCAGCAGCCAGG - Intronic
933455198 2:82511034-82511056 GCTCATTATCAGCAGCAGCAGGG + Intergenic
934996696 2:98968265-98968287 TGTCATTTGCAGTAGCAGCATGG - Intergenic
935220494 2:101008160-101008182 CCCGATCTGCAGCAGCAGTGTGG + Exonic
935619704 2:105118046-105118068 CATCATCTTCTGCACCAGCAGGG + Intergenic
935639502 2:105277613-105277635 CCTGAACTGCAGCAGCATCTTGG + Exonic
936247698 2:110842968-110842990 CCTCAGCAGCTGCAGCAGCCTGG - Intronic
936444773 2:112586817-112586839 CCTCATCTGCAACTGCAGAGGGG + Intronic
936712065 2:115142886-115142908 CACCACCAGCAGCAGCAGCAAGG - Intronic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
938297934 2:130190083-130190105 CATCAGCGGCGGCAGCAGCAGGG - Intronic
938581651 2:132651961-132651983 GCACAACTGCAGCAGCAACATGG + Intronic
940262995 2:151803621-151803643 CCTCAGCTTCCCCAGCAGCAGGG + Intronic
940694018 2:156956326-156956348 GCTCATCTGAATCAGCAGCTTGG - Intergenic
940725071 2:157327769-157327791 CATCATCCTCAGCAGCTGCAGGG - Intergenic
943085381 2:183304653-183304675 CCAGGTCTTCAGCAGCAGCAAGG - Intergenic
943212110 2:184980193-184980215 CCTCATCTCCTGCAGCTGCAGGG + Intergenic
943396714 2:187346839-187346861 AATCAGCAGCAGCAGCAGCAGGG + Intronic
943653435 2:190481828-190481850 ACTTAGCAGCAGCAGCAGCATGG - Intronic
946160569 2:217833316-217833338 ACTCATCTGCCTCAGCAGAAGGG - Intronic
946409545 2:219509261-219509283 CCACATCTGCTGCATCCGCACGG + Intergenic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947936304 2:234007251-234007273 CCACCTCTGCGGCCGCAGCAGGG - Intronic
948034698 2:234848534-234848556 CCTTCTCAGCAGCTGCAGCAGGG + Intergenic
948454421 2:238098164-238098186 CCTCAGCAGCAGCTGCAGCTCGG + Intronic
948635035 2:239329415-239329437 CAGCCTCTGCAGCAGCAGCTTGG + Intronic
948635174 2:239330046-239330068 CAGCCTCTGCAGCAGCAGCTTGG - Intronic
1169469569 20:5872072-5872094 TCCCATCTCCACCAGCAGCAGGG + Intergenic
1170107037 20:12762957-12762979 CTTCATCTGCTGCAGCAGGCTGG + Intergenic
1170150524 20:13221793-13221815 CCCCAGCAGCAGCAGCAGCTCGG - Exonic
1171311912 20:24151426-24151448 TCTCATCTTCTGCAGCAGCCAGG + Intergenic
1171491742 20:25524255-25524277 AGGCATCTGCAGCACCAGCAGGG + Intronic
1172660139 20:36562413-36562435 CCTCAGCTGCAGGAGTAGCTGGG - Intergenic
1172961003 20:38799589-38799611 CATCATCAGGAGTAGCAGCATGG + Intergenic
1173955995 20:47033114-47033136 GCTCACCTGCAGCAGCAGCTGGG - Intronic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175070774 20:56332021-56332043 CCCCAGCTGCAACAGAAGCAGGG - Intergenic
1175575641 20:60058574-60058596 ACGCAGCGGCAGCAGCAGCAAGG - Intronic
1175922850 20:62458199-62458221 CCTCCTCCACAGCAGCAGGAGGG - Intergenic
1175940449 20:62535333-62535355 CCTCCTCCCCACCAGCAGCAAGG - Intergenic
1175945341 20:62555941-62555963 CCCCATCTGGCGTAGCAGCAAGG + Intronic
1176276860 20:64277543-64277565 CCTGATGCCCAGCAGCAGCAGGG - Intronic
1176297300 21:5080909-5080931 CCTCATCTGGAGCATAAGGATGG - Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1178254951 21:31043981-31044003 CAGCATCTGCAGCAGGAGCCTGG - Intergenic
1179859729 21:44181039-44181061 CCTCATCTGGAGCATAAGGATGG + Intergenic
1180009501 21:45040319-45040341 CCACAGCAGCAGCAGCAGCATGG - Intergenic
1180216690 21:46328033-46328055 CCCATTCTGCTGCAGCAGCAGGG - Intronic
1180246584 21:46552342-46552364 CCAAATCAGCAGCAGGAGCAGGG - Intronic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181647725 22:24242836-24242858 CCTGTTCCGCAGCAGCAGCTGGG + Intronic
1181687171 22:24537463-24537485 CCACATCTCCACCAGCAGCAGGG - Intergenic
1181694920 22:24588247-24588269 CCTCACTCGAAGCAGCAGCAAGG - Exonic
1181899790 22:26144078-26144100 CCACATATGCAGCAGCAGACTGG - Intergenic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182740952 22:32567153-32567175 CCTCATCTCCAACCCCAGCAGGG - Intronic
1183173859 22:36207913-36207935 CCTCATCTTCCCCAGCAGCTGGG + Intergenic
1183541043 22:38429634-38429656 CCTCTTCTGCTGCAACAGCTGGG - Intronic
1183719509 22:39554343-39554365 CAGCAGCTGCTGCAGCAGCAAGG + Intergenic
1183740315 22:39665254-39665276 TCAGATCTACAGCAGCAGCAGGG - Intronic
1183747006 22:39697852-39697874 CCTCATTCGCAGAAGCAGGAAGG - Intergenic
1183861383 22:40672865-40672887 CCTCATCTTCTGCAGCAATAAGG + Intergenic
1184091670 22:42296190-42296212 CATCATCTTCAGCAGCAGCCTGG + Intronic
1184440440 22:44509454-44509476 CATCAACTGAAGCAGCAACAAGG + Intergenic
1184936648 22:47728896-47728918 CCTCATGGGGAGCAGCACCACGG + Intergenic
1185313974 22:50170843-50170865 CTTCAGCTGCAGAAGCAGCGCGG - Exonic
949731207 3:7115461-7115483 TCTCATTGGCAGGAGCAGCAAGG - Intronic
949892801 3:8745822-8745844 CCAGGTCTGCAGCAGCATCAAGG + Exonic
951477202 3:23119472-23119494 CCAGAACAGCAGCAGCAGCAGGG - Intergenic
952132869 3:30384819-30384841 CCTCATCTCAAGCAGAAGGAAGG + Intergenic
953771775 3:45783049-45783071 CCTCATGTGGAGCACCATCAGGG - Intronic
954499132 3:50993544-50993566 CCTCCTCTGCACCCCCAGCATGG + Intronic
954619272 3:51986398-51986420 CCTCATCTGTAAAAGCAGCAGGG - Exonic
954749312 3:52804709-52804731 CTGCATCTGCAGGTGCAGCAAGG - Exonic
955063182 3:55511916-55511938 CCTCATCTGAAGCAGTAGTGTGG - Intronic
955343742 3:58145670-58145692 CCTCATCTGGAGCAGCTTCCAGG + Intronic
957482500 3:80816454-80816476 TCTCAGCAGCAGCACCAGCACGG - Intergenic
957503361 3:81086880-81086902 CCATATCTGGAGCATCAGCATGG + Intergenic
959111228 3:102124827-102124849 ACTCATCTGCAAAAGCAACATGG + Intronic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
960295959 3:115944204-115944226 TCTCCTCAGCAGCATCAGCAAGG - Intronic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
961375186 3:126460498-126460520 CCACAGCTGCAGCTGCACCAGGG + Intronic
961741234 3:129034262-129034284 CCTCAGCTGCTCCACCAGCATGG - Exonic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964850930 3:161095523-161095545 CCCCATGGGCAGCATCAGCAGGG - Intronic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
967188469 3:186965367-186965389 TCTAATCTGCTGCAACAGCAGGG - Intronic
967532161 3:190561044-190561066 AATCATCTGAAGCAACAGCAGGG + Intronic
969310079 4:6347903-6347925 CTTCGTCTACAGCAGCAGCAAGG - Exonic
969433040 4:7167150-7167172 CCTCGGCTGGGGCAGCAGCACGG + Intergenic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
971537381 4:27770922-27770944 CATCATCTGCCGGAGCAGCCTGG + Intergenic
973032215 4:45359320-45359342 CAGCCTCTGCAGCAGCAGCCTGG - Intergenic
973169416 4:47120877-47120899 CCTCTTCTGAAGCAGAAGAAAGG + Intronic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
974064602 4:57065956-57065978 CCCCATCTCCAGCCCCAGCATGG + Intronic
975722620 4:77262894-77262916 TCTCATGAGCAGCATCAGCATGG - Intronic
976880860 4:89923236-89923258 GCTGAGCAGCAGCAGCAGCAAGG + Exonic
978054782 4:104249661-104249683 CCTCTTCTGCAGGAGCTGCTGGG + Intergenic
978424482 4:108567739-108567761 CTCCCTCTGCAGCTGCAGCAAGG - Intergenic
979531067 4:121769647-121769669 CCTCATCTCCAGCACATGCATGG - Intergenic
979727785 4:123985064-123985086 CATCATCAGCAGCTGCTGCAGGG + Intergenic
979812508 4:125055356-125055378 CCCCATCAGCAGAAGCAGCTAGG + Intergenic
980027119 4:127781014-127781036 CTACAGCAGCAGCAGCAGCAAGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981578373 4:146228265-146228287 CCTCCTCTGCAGCTCCAGGAAGG - Exonic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
983674727 4:170279485-170279507 TCCCATCTGTAGCAGCAGCTAGG - Intergenic
985041457 4:185895485-185895507 CTGCATCTGCTGCAGCAGAACGG - Intronic
985235729 4:187871935-187871957 ACTGATCTGCAGCAGCAGTTAGG + Intergenic
985904411 5:2822593-2822615 CCACAGCTGCAGCAACAGAATGG - Intergenic
986466923 5:8034994-8035016 CCTGAGCAGCAGCAGCACCAGGG + Intergenic
986955861 5:13148633-13148655 CCTCTTCTGAAGCAGCTGCCAGG - Intergenic
986978080 5:13415602-13415624 CCACATCTGGAGCTGCAGGAAGG - Intergenic
987160002 5:15132396-15132418 TCATATCGGCAGCAGCAGCAGGG + Intergenic
987168117 5:15222065-15222087 TTTCATCTCCTGCAGCAGCAGGG - Intergenic
987741976 5:21920948-21920970 CCTCCTCTGCAGCAGATGCTTGG + Intronic
987942833 5:24564520-24564542 TCTCAGCTCCATCAGCAGCACGG - Intronic
988001688 5:25358127-25358149 CCTCTTCTGAAGCAGAAGGAAGG - Intergenic
989255583 5:39362916-39362938 CCCCAGCTCCAGCAGCTGCACGG - Intronic
992508425 5:77410058-77410080 CCTGTCCTGCATCAGCAGCAGGG - Intronic
992676327 5:79109796-79109818 CTTGATCTGCAACAGCAGCTGGG + Intronic
992710397 5:79447686-79447708 GCTCATGTACAGCAGCAGAAAGG + Intronic
993009066 5:82459172-82459194 ACTCATCTGGATCAGCAGCTTGG + Intergenic
995088443 5:108142810-108142832 TCAGATCAGCAGCAGCAGCAGGG + Intronic
995372682 5:111437178-111437200 CATCATCTTTAGCAGAAGCATGG - Intronic
996014236 5:118514972-118514994 TGTAATTTGCAGCAGCAGCATGG - Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996962690 5:129270078-129270100 TCTCAAAGGCAGCAGCAGCACGG + Intergenic
998493449 5:142566621-142566643 ATTCAGCAGCAGCAGCAGCAGGG - Intergenic
998940870 5:147280615-147280637 CCACAGCAGCAGCAGCAGCAAGG + Intronic
999207067 5:149856692-149856714 CCTGATTTGCAGAAGCAGTATGG + Intergenic
999482263 5:151959564-151959586 GCTCATCTGTATCAGCAGCCGGG - Intergenic
999720506 5:154395937-154395959 CCTCATCGGAAGCACCTGCAGGG - Intronic
999945688 5:156592709-156592731 CCTCATCTGCAGCATCAAAGTGG + Intronic
1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG + Intergenic
1002155084 5:177271415-177271437 CCTCATCTGCAAGATCAGGATGG - Intronic
1002252175 5:177936673-177936695 TCTCATCTGCACCAGGAGGACGG - Intergenic
1002810431 6:623021-623043 CCTCATCCTCAGAAGGAGCAGGG + Intronic
1003096932 6:3149580-3149602 CCCCAACTTCATCAGCAGCAAGG + Intronic
1004293735 6:14391499-14391521 CATTATCTGGAGCAGCAGAATGG + Intergenic
1006027191 6:31154667-31154689 CCTCATCTTCTGCTGCAGCGAGG + Exonic
1006378824 6:33686121-33686143 CATCATGTGCGGCAGCACCACGG + Exonic
1006447409 6:34087561-34087583 GCTCCTCTGCAGCATCACCAGGG - Intronic
1006598028 6:35207785-35207807 CCTGAACTGTGGCAGCAGCAAGG + Intergenic
1007396528 6:41581134-41581156 CCTGGGCTGCAGCTGCAGCAAGG - Intronic
1007497246 6:42268635-42268657 CTACAGCTGCAGCAGCGGCAGGG - Exonic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1009034925 6:58105595-58105617 CCTCTTCTGAAACAACAGCATGG - Intergenic
1009210441 6:60856312-60856334 CCTCTTCTGAAACAACAGCATGG - Intergenic
1009493368 6:64319820-64319842 TCACAACAGCAGCAGCAGCAGGG - Intronic
1010723237 6:79307713-79307735 CCATATGTGCAGCATCAGCAAGG + Intergenic
1011399929 6:86949355-86949377 CAACAGCAGCAGCAGCAGCAGGG - Intronic
1011743591 6:90387644-90387666 CCTCAGCTGCCGCAGAAGAAAGG + Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012480689 6:99663770-99663792 ACTCACCTGGAGAAGCAGCAAGG - Intergenic
1014383728 6:120776518-120776540 CTTAGTCTGCAGCAGTAGCATGG + Intergenic
1015499882 6:133920975-133920997 CCACACCTGCTGCAGGAGCATGG + Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018360636 6:163063817-163063839 CCTCATCCACAGCTGCAGGAAGG + Intronic
1018580334 6:165302466-165302488 TCTCATCTGCAGCAGCACACTGG - Intronic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1019613404 7:1948116-1948138 CCTCATCTGGGGCACCTGCAGGG + Intronic
1019666579 7:2254926-2254948 CCTCTGCTCCAGCTGCAGCACGG + Exonic
1019684652 7:2374428-2374450 CCTCATGGGCAGCATGAGCACGG + Intronic
1019727327 7:2610373-2610395 CCTCATCTCCAGCTGCAGCTCGG + Exonic
1021170497 7:17393519-17393541 CTTTATCAGCAGCAGCAACATGG - Intergenic
1022678367 7:32521876-32521898 CCACAGCTGAAGCAGCAGCTGGG - Intronic
1023976875 7:45037041-45037063 ACTGATGTGCAGCCGCAGCAAGG - Intronic
1024001489 7:45192545-45192567 CCTCATCAGCTGCAGCACCCAGG - Intergenic
1024709447 7:51999059-51999081 GCTCATCTGAAGGGGCAGCAAGG - Intergenic
1025281604 7:57629733-57629755 CCGCATCTCCAGCAGCACCCCGG - Intergenic
1025303126 7:57835782-57835804 CCGCATCTCCAGCAGCACCCCGG + Intergenic
1027628586 7:80574946-80574968 TGGCAGCTGCAGCAGCAGCAGGG + Intronic
1031450611 7:121913463-121913485 TTTCATCTGTAGCACCAGCAAGG + Intronic
1032669971 7:134073817-134073839 CCTGACCTGCTTCAGCAGCAGGG - Intergenic
1034380179 7:150685339-150685361 CCTCATTGACACCAGCAGCAGGG - Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1034971974 7:155424845-155424867 CCTCATCTGCAGCCTCAGCTGGG - Intergenic
1035123577 7:156590618-156590640 CCAAATCTGCAGCAGGAGAAGGG + Intergenic
1036094588 8:5709956-5709978 ACCCATCCGCAGCAGCACCAGGG - Intergenic
1036824881 8:11968275-11968297 TGTCATCTGCAGCTGCAGCTGGG - Intergenic
1038382420 8:27108838-27108860 CCTCATTTGCAGGAGCAGGCAGG + Intergenic
1039018265 8:33177157-33177179 CCTAAGGTACAGCAGCAGCAAGG + Intergenic
1039479278 8:37859790-37859812 CAGCATCTGCAGCAGCTGGAAGG + Exonic
1042984346 8:74566521-74566543 CCTCATCTGCTTCAGGAGCCTGG - Intergenic
1044313883 8:90727063-90727085 CAGCAGCGGCAGCAGCAGCATGG - Intronic
1044409438 8:91867746-91867768 CCTGGTCTGCAGCCACAGCAGGG - Intergenic
1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG + Intergenic
1044955539 8:97475977-97475999 GCTCATCTGGATCAGCAGCCTGG + Intergenic
1046271161 8:111899213-111899235 TCTCGTGTGCAGCAGCAGGATGG - Intergenic
1046347283 8:112947869-112947891 CCTCATTTACTGCAACAGCAGGG + Exonic
1047381891 8:124372131-124372153 CCTCAGCAGCGGCAGCAGCCGGG + Exonic
1048250615 8:132863928-132863950 CCCCACCTGGAGAAGCAGCAAGG - Intergenic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048396087 8:134015265-134015287 CCTCATTTCCAGCAGCAGTCGGG - Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048932478 8:139326091-139326113 TCTCATCTTCTGCAGCAGGAGGG + Intergenic
1049162311 8:141105235-141105257 CCTCATCTCCTGCAGCCCCAGGG + Intergenic
1049173826 8:141179189-141179211 CTTGAGCTGCAGCAGCAGCCGGG + Intronic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1049741589 8:144243544-144243566 CGCCATCTGCAGCAGCACCCAGG + Exonic
1049847091 8:144808058-144808080 GCGCAGGTGCAGCAGCAGCAGGG - Exonic
1049855318 8:144858041-144858063 GCTCAGCTGAAGCAGCAGCTTGG + Intergenic
1049928141 9:429764-429786 GCACCACTGCAGCAGCAGCATGG + Exonic
1052352311 9:27470306-27470328 TCTCTTCTGCAGCTGAAGCAGGG + Intronic
1053646434 9:40122375-40122397 CCCCAGCAGCAGTAGCAGCAGGG - Intergenic
1053759279 9:41341176-41341198 CCCCAGCAGCAGTAGCAGCAGGG + Intergenic
1054327446 9:63720277-63720299 CCCCAGCAGCAGTAGCAGCAGGG - Intergenic
1054538135 9:66253598-66253620 CCCCAGCAGCAGTAGCAGCAGGG + Intergenic
1054965985 9:71026941-71026963 CGTGCTCAGCAGCAGCAGCAGGG - Intronic
1055391505 9:75826772-75826794 CCTCAGCAGCATCAGTAGCAAGG + Intergenic
1055671350 9:78609600-78609622 GCTCATGTGCGGCAGCTGCATGG + Intergenic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1057077479 9:92146264-92146286 CCTCATCTGTAGCCCCTGCAGGG - Intergenic
1057904646 9:98974545-98974567 CCTCCTCTGCGCCTGCAGCATGG - Intronic
1058413609 9:104762862-104762884 CCTCATCTGCCACAGAAGGAAGG + Intergenic
1059990311 9:119859139-119859161 TCTCACCTTCAGCAGCAGAAGGG + Intergenic
1060045048 9:120333214-120333236 CCTAACCTGCAGCAGCAGGGGGG + Intergenic
1060533524 9:124364172-124364194 CCTCATCTGTACCAGCAGTTGGG - Intronic
1060748770 9:126155125-126155147 CCTCAGGTTCAGCAGCAGCGAGG + Intergenic
1060848653 9:126857431-126857453 CCTCCTCTGCAGAGGCAGCCAGG + Intergenic
1060886972 9:127161258-127161280 CCCTATTTGAAGCAGCAGCATGG - Intronic
1061036636 9:128118029-128118051 CCCCATCTGCAGCAGCCCCGGGG + Intergenic
1186196298 X:7113132-7113154 CCTCCTCTGCAGCAGCATGGGGG - Intronic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1194897531 X:99463336-99463358 TCTGATCTGCAACAGCAGCTGGG + Intergenic
1195068121 X:101255548-101255570 CCTCATCTGAAGTTGCAGAAAGG + Intronic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196722196 X:118864847-118864869 CCTCATCTGCTGGAGGGGCAAGG + Intergenic
1196885632 X:120242919-120242941 CCTTATTTGCAGGAGCAGAATGG - Intergenic
1197010151 X:121551146-121551168 CTTCAACCCCAGCAGCAGCAGGG + Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1199440845 X:147866433-147866455 CCAACCCTGCAGCAGCAGCATGG + Intergenic
1199529597 X:148831570-148831592 CCTTATCTGCAGCAGCAGTGGGG - Intronic
1199982447 X:152928419-152928441 GCTCAGCTGCAGCACCAACAAGG + Intronic
1200037642 X:153343783-153343805 CTTCCTGTGCAGCATCAGCATGG + Intronic
1200110078 X:153736547-153736569 CAGCACCTGCAGCAGCAGCAGGG - Intronic
1201251699 Y:12065086-12065108 ACTCATGTCCAGCAGCACCATGG - Intergenic
1201567850 Y:15385295-15385317 CAGCTTCTGCAGCAGCTGCAAGG + Intergenic