ID: 1089811740

View in Genome Browser
Species Human (GRCh38)
Location 11:121137822-121137844
Sequence CAGCTGGTCTGGAAGTCAAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089811740_1089811746 1 Left 1089811740 11:121137822-121137844 CCCTTTGACTTCCAGACCAGCTG 0: 1
1: 0
2: 0
3: 12
4: 181
Right 1089811746 11:121137846-121137868 CCACTCATCCTGTGCACCACAGG 0: 1
1: 0
2: 0
3: 7
4: 101
1089811740_1089811747 8 Left 1089811740 11:121137822-121137844 CCCTTTGACTTCCAGACCAGCTG 0: 1
1: 0
2: 0
3: 12
4: 181
Right 1089811747 11:121137853-121137875 TCCTGTGCACCACAGGAAGCAGG 0: 1
1: 0
2: 1
3: 28
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089811740 Original CRISPR CAGCTGGTCTGGAAGTCAAA GGG (reversed) Exonic
900131509 1:1089215-1089237 CAGCGGGTCGTGAAGTCCAAGGG - Intronic
900275260 1:1821922-1821944 CAGCTGGTCTTGAACTCCTAGGG - Intronic
903780577 1:25817815-25817837 CATCTGGTCTGGAGGTCAGAGGG - Exonic
905272557 1:36796419-36796441 CAGCTGGTCTCTGGGTCAAATGG + Exonic
906000747 1:42422718-42422740 CAGCTGGTGTGCAAGTGAATAGG - Intergenic
906706524 1:47899157-47899179 CACCTGGAGTGGAAGTCAGATGG - Intronic
915871091 1:159560293-159560315 CAGGTGGTATGAAAGTCAATAGG + Intergenic
917016644 1:170539321-170539343 CAGCTGCTCTGGAAGTAATGAGG - Exonic
918578205 1:186090823-186090845 GAGCTGGTCTGCAATGCAAATGG + Exonic
918682123 1:187368861-187368883 CAGCTGGTATAGCACTCAAAGGG + Intergenic
920099111 1:203505827-203505849 CTGCTGCTCTGAAAGTCAAGGGG - Intronic
920777363 1:208952947-208952969 CAGCTCTTCTGGAAATCTAATGG + Intergenic
921818961 1:219594744-219594766 CAGCAGGCCAGGAAGTCAACAGG + Intergenic
1064091045 10:12385145-12385167 CTGCTGGTGTGGATGTAAAATGG + Intronic
1064675660 10:17757483-17757505 CAGCTGCTCTGGGAGCTAAAGGG + Intronic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1066205585 10:33186281-33186303 CAGCTGGTCTGGATGGCCATTGG - Exonic
1066288140 10:33988518-33988540 CAGTTGGTCTGGAAGAAAAGAGG - Intergenic
1068793104 10:61048702-61048724 CAGCTCATCTGGAATCCAAAGGG - Intergenic
1072325975 10:94299027-94299049 CAGTTGTTCTTGCAGTCAAAAGG + Intronic
1073488201 10:103835170-103835192 CAGCAGCTCTGGAAACCAAAGGG + Intronic
1075016789 10:118915577-118915599 CAACTGGTCTGGTAGGCAAAGGG - Intergenic
1075267985 10:121021837-121021859 CTACTGGTCAAGAAGTCAAAGGG - Intergenic
1075441200 10:122480475-122480497 GAGCTGGCCTGGGAGTCTAATGG + Intronic
1076130383 10:128009982-128010004 GAGATGGTCTGGAACTCACAGGG + Intronic
1079278194 11:19061554-19061576 CAGCTGCTCTGGAATGCAAAGGG - Intergenic
1079635818 11:22739213-22739235 CTTCTGGCCTGGAAGACAAATGG + Intronic
1079764475 11:24374261-24374283 GAACAGGTCTGGAAGTCATAAGG - Intergenic
1081028645 11:38048923-38048945 TAGCTGGTCTGGAACTACAATGG + Intergenic
1083989460 11:66237972-66237994 CAGCTGGGCTGGGAGTCCAGAGG - Intronic
1084050202 11:66594387-66594409 CAGCTGGTCTGGAGGTGACCTGG + Intronic
1085224452 11:74907060-74907082 GTGCTGTTCTGGAAGCCAAAAGG - Intronic
1085661072 11:78367303-78367325 CATATGGTCTGGAAGTGTAAAGG + Intronic
1088194139 11:107257311-107257333 CAGCTGGTCTGTAAGGCTAAGGG - Intergenic
1089464112 11:118672985-118673007 CTGCTTTTCTGGAAGTTAAAGGG - Intronic
1089811740 11:121137822-121137844 CAGCTGGTCTGGAAGTCAAAGGG - Exonic
1092255075 12:6922450-6922472 CAGATGGTCTGGCAGGCAAATGG - Intronic
1092940979 12:13406719-13406741 CAGCTGGTCTTGAAAGCAAGTGG - Intergenic
1095193996 12:39290940-39290962 CTGCTGGTCTTGGAGTCAACAGG - Intergenic
1097089838 12:56496132-56496154 CAGCTGGTTCAGAATTCAAAAGG + Intergenic
1100913410 12:99390805-99390827 CAGCTGGTCTGAAAGCCAACTGG + Intronic
1101483713 12:105129600-105129622 CAGCTGATCAGGATGTCAGAAGG + Intronic
1101724525 12:107377976-107377998 CATCTGGTAGGGAAGTAAAAGGG + Intronic
1102410687 12:112715684-112715706 CAGCTGCTCTGGAATGCCAAGGG - Intronic
1102412261 12:112730300-112730322 CAGCTGGACAGCAAGTCTAATGG - Intronic
1103202142 12:119096562-119096584 ACGCTGGGCTGGGAGTCAAAAGG + Intronic
1107181784 13:37469821-37469843 CAGCTGCACTGGCAGTCAATTGG - Intergenic
1111694216 13:91603200-91603222 CAGGTGGTCTGGATGAGAAACGG - Intronic
1111845722 13:93506440-93506462 TAGCATGTCCGGAAGTCAAAAGG + Intronic
1112422754 13:99268022-99268044 CAGCTGGTGTGGAAGAAAGAAGG + Intronic
1114702423 14:24692753-24692775 GAGGTGGGCAGGAAGTCAAAGGG + Intergenic
1115369035 14:32591208-32591230 CAGGGCCTCTGGAAGTCAAATGG + Intronic
1118385138 14:65249984-65250006 CAGCTGGTTTGAAAGTACAATGG - Intergenic
1120485364 14:85106851-85106873 CAGCTTGTCTGGAATACAATTGG - Intergenic
1121212181 14:92215535-92215557 CACCTGGCTTGGAAGTAAAATGG - Intergenic
1122142229 14:99669149-99669171 CAGCTGCTCTGGGAGTCTCAGGG + Intronic
1123830265 15:24128918-24128940 AAACTGTTCTGGAAGCCAAAAGG + Intergenic
1126747125 15:51837453-51837475 CAGCTGGTCTAGCACTCAAGTGG - Intronic
1129365320 15:75050512-75050534 CACCTGGCCTGGAAGCCAGAGGG - Exonic
1133374486 16:5273128-5273150 CAGCTTGTTTGGAGGTGAAATGG + Intergenic
1133503500 16:6387815-6387837 AAGCTCTCCTGGAAGTCAAAAGG - Intronic
1133520764 16:6554242-6554264 AAGCTGGGCAGGAAGGCAAAAGG + Intronic
1137699943 16:50490260-50490282 CATCTTGTCTAGATGTCAAAGGG + Intergenic
1140171354 16:72608045-72608067 TTGCTGGTGAGGAAGTCAAATGG + Intergenic
1141607174 16:85160709-85160731 CAGCTGCTCTGGAAGGCAGGGGG + Intergenic
1142031211 16:87839471-87839493 CAGCTGCTGGGGGAGTCAAAGGG - Intronic
1144602750 17:16632909-16632931 CATGTGTTCTGGAAATCAAAAGG - Intronic
1150592300 17:66574301-66574323 CAGCTGGACTTCAATTCAAATGG + Intronic
1152878151 17:82800152-82800174 GAGATGGGCTGGAAGTGAAATGG - Intronic
1153503348 18:5770671-5770693 CAACTGATCTAGAACTCAAAGGG - Intergenic
1157571909 18:48718170-48718192 CAGATGGTTTGGAAGAAAAAAGG - Intronic
1157922554 18:51728218-51728240 CTGCTGGTCTGGAAGAGAGAAGG + Intergenic
1158371248 18:56807026-56807048 AAGCTGCTTTGGAAATCAAAGGG - Intronic
1158713775 18:59860183-59860205 CAGCTGTCCTGGAAGACAGATGG - Intergenic
1162250364 19:9437489-9437511 CAGCTGGTCTAAAAACCAAAAGG - Intergenic
1162450089 19:10749249-10749271 CATAGGGGCTGGAAGTCAAAAGG + Intronic
1165733349 19:38160378-38160400 CAGCTGCTCTGGATGTCAACTGG - Intronic
1166723706 19:45012411-45012433 CACCTGGCCTGGAATCCAAAAGG + Intronic
1166931543 19:46304267-46304289 CAGCAGGCCAGGAACTCAAAGGG - Intronic
1167739151 19:51313240-51313262 CAGGTGGTCAGAAAGTCAGAGGG - Intronic
1168466925 19:56610230-56610252 CAGCTGGTGGGGATGTAAAATGG - Intronic
926014808 2:9441392-9441414 GAGCTGGCCTGGAAATCAAAAGG - Intronic
926251989 2:11159932-11159954 CAGCTCTTCTGGAAGGCAACTGG + Intronic
926422265 2:12711697-12711719 TAGCTGGTCTAGCATTCAAAAGG + Intergenic
926521079 2:13914683-13914705 CTGCTGGTCTGAATGTAAAATGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932437376 2:71710577-71710599 CAGCTGTTCTGGATGTCTAAGGG + Intergenic
937966732 2:127517616-127517638 CAGCTGGTATGAATGTAAAATGG + Intronic
940047523 2:149425062-149425084 CAGCTTATCTGGAAGAAAAAAGG - Intronic
940771587 2:157844698-157844720 CAGCAGCTCTTGAGGTCAAAAGG - Intronic
948735242 2:239999416-239999438 CAGCTGTGCTTGAAGTCAGAGGG - Intronic
1169157875 20:3349141-3349163 AAGCTGGTCTGGAAGTCCTGGGG - Intronic
1169494190 20:6098121-6098143 CAGCAGCCCTGGAAGTAAAATGG - Intronic
1171342574 20:24442106-24442128 CAGCTGCTCTGGTAGCGAAATGG - Intergenic
1172323236 20:34013681-34013703 CAGCAGTCCTAGAAGTCAAAGGG - Intronic
1175391230 20:58628647-58628669 CAGCTTGCCTAGAAGTCAGAGGG - Intergenic
1178243236 21:30926278-30926300 CAGCTGGTGCTGAAGTCAAGGGG - Intergenic
1180850398 22:19016392-19016414 CAGCTGGGCTGGACATCACATGG + Intergenic
1182394069 22:30022613-30022635 CAGGTGGTCAGGAAGCCAACGGG - Exonic
1184345476 22:43910159-43910181 CAGGTTTTCTAGAAGTCAAAGGG - Intergenic
951292676 3:20892793-20892815 CAAATGTTCTAGAAGTCAAATGG + Intergenic
953448582 3:42988137-42988159 CAGCTGGGCTGGAGGCCAGAAGG - Intronic
957760409 3:84548470-84548492 CAGCTGCTCTGGGAATCCAAAGG + Intergenic
958735283 3:98001973-98001995 CTGCGGGTTTGGAAGTTAAAGGG - Intronic
962599735 3:136982626-136982648 AAGCTGCTCTGGAAGTGAAGAGG + Intronic
964815269 3:160710653-160710675 CAGTTGGCCTGGAATTCACAAGG + Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
967734254 3:192935517-192935539 CATCTGGGGTGGAAGTCACATGG + Intergenic
969114311 4:4861437-4861459 CTGGTGGTCTGAAAGTCCAAAGG + Intronic
972359437 4:38313994-38314016 GGGCTGGTCTGGAAATAAAACGG - Intergenic
973788388 4:54356450-54356472 CAGCTGCCTTGGATGTCAAATGG - Intergenic
975877948 4:78866859-78866881 AGGCTGGTCTCGAACTCAAAGGG + Intronic
976121879 4:81792040-81792062 CATCTATTCTGGAAGGCAAAGGG + Intronic
976310328 4:83605270-83605292 CACCTGCTCTGAAAGTCAAAAGG + Exonic
976877620 4:89873840-89873862 CAGCCAGTGTGGAAGCCAAATGG + Intergenic
978355171 4:107864439-107864461 TAGTTGGCCTGAAAGTCAAAAGG + Intronic
978448885 4:108807306-108807328 CAGTTGGTCTGAAAGTCGGAAGG + Intergenic
979817069 4:125121825-125121847 CAGCTGTTCTGGAAAAAAAAAGG + Intergenic
982017610 4:151170784-151170806 CACATGGTCTGAAATTCAAAAGG + Intronic
983204783 4:164901187-164901209 CAGCTAGTCAGGAAGGCAGATGG - Intergenic
984009957 4:174358560-174358582 CAGGTGGCTTGGAAGTCCAAGGG - Intergenic
985052614 4:186008127-186008149 CACATGGTCTGGAAGTGAAGAGG - Intergenic
985055545 4:186032756-186032778 CAGCTGGGCTGGATGCCACAGGG + Intergenic
986232894 5:5883354-5883376 CAGCTGGTCTGGAAGGCTCTGGG + Intergenic
989190387 5:38664960-38664982 CAGCTGCTGTGGAAGTGAGAGGG + Intergenic
995324967 5:110880128-110880150 CAGCTGCTCTGGGAGAGAAAGGG - Intergenic
996362729 5:122668546-122668568 CAGCTGGAGTGAAAATCAAATGG + Intergenic
997901390 5:137768540-137768562 CAGCTGGTCTGGGAAATAAAGGG - Intergenic
999088117 5:148911269-148911291 CAGCTGGTGTGGAGGTGAATGGG + Intergenic
1001550582 5:172599415-172599437 CTGCTGGTGGGGATGTCAAATGG + Intergenic
1002100634 5:176855875-176855897 GAGCTGTTCTGGATGTGAAATGG - Intronic
1002334190 5:178466744-178466766 CAGCTGGGCTGGAAATGTAATGG - Intronic
1003809043 6:9759099-9759121 CAGCTGGTTTTGAAACCAAACGG + Intronic
1005098885 6:22147713-22147735 CAGCTGGTCTCAAAGTCATCTGG - Intergenic
1005544976 6:26857714-26857736 GAGCTGATATGAAAGTCAAAAGG - Intergenic
1007276414 6:40677562-40677584 CTCCTGGTCTGGAACTCTAATGG + Intergenic
1008065508 6:47043646-47043668 CAGCTGGTGTGGAAGACAAGTGG - Intergenic
1009566710 6:65319869-65319891 CAGCAGGCCAGGAAGTCAATAGG - Intronic
1013654171 6:112228198-112228220 CAGCTGGCCTGGAGTTGAAATGG + Intronic
1014183045 6:118406474-118406496 CAGCCAGGCTGGCAGTCAAAGGG + Intergenic
1017602671 6:156100586-156100608 CAGCTGGTCAGCAAAGCAAATGG - Intergenic
1017795301 6:157838960-157838982 CAGCTTACCTGGAAATCAAAAGG - Intronic
1018583649 6:165332754-165332776 AGGCTGGTTTGCAAGTCAAATGG + Exonic
1020944849 7:14590532-14590554 AAGCTGGTCTGACAGTCACATGG - Intronic
1021762514 7:23915011-23915033 AAGCTAGGCTGGAAGACAAATGG - Intergenic
1022531674 7:31070598-31070620 CAGCTGCTCTGAGACTCAAAAGG + Intronic
1022819206 7:33942475-33942497 CAGCAGGCCTGGAAGCCTAATGG - Intronic
1023337009 7:39180845-39180867 AAGGTGCTCTGGAAGGCAAAGGG - Intronic
1024307003 7:47937713-47937735 CTGCTGGACTGGAAGTGAGATGG + Intronic
1024335989 7:48205256-48205278 CCGCTGGTCTGGAATTCATCTGG + Intronic
1024604676 7:51013827-51013849 CAACTGGTTTGGAACTTAAAAGG - Intergenic
1025015874 7:55438809-55438831 CAGCGGGTCTGGGAGGGAAACGG + Intronic
1027270698 7:76516954-76516976 CAGCTGGTCTGGAACTCCTGGGG - Intergenic
1030443948 7:109625551-109625573 CAGCTAGCCTGGAAATCACAGGG - Intergenic
1032774622 7:135098636-135098658 GAGCAGATCTGAAAGTCAAAGGG + Intronic
1033639332 7:143246119-143246141 CATCTGATGTGGGAGTCAAAAGG - Intronic
1034450504 7:151134769-151134791 CAGTTGATCTGGATGTCAGATGG + Intronic
1036520773 8:9489603-9489625 CAGCTCATCTGGAAGTCAGCCGG - Intergenic
1036701815 8:11018094-11018116 GAGCAGCTCTGGATGTCAAAGGG + Intronic
1039790625 8:40872845-40872867 CAGCTGTTTTGGAATTTAAAGGG + Intronic
1040857438 8:51962369-51962391 CAGCTGCTCTGGAAGGCAGAAGG + Intergenic
1041971463 8:63747597-63747619 CAGTTGGTCAGGAGCTCAAATGG - Intergenic
1042392961 8:68256962-68256984 CAGCTAGAGTGGAAGCCAAATGG + Intergenic
1042489463 8:69381254-69381276 CAAATGGTCTGGAAGAGAAAGGG + Intergenic
1042700970 8:71613964-71613986 CACTTGGTCTGGAATTCAACAGG + Intergenic
1044739775 8:95314395-95314417 TAGCTGTTATGGAAGTGAAAAGG + Intergenic
1044847626 8:96397811-96397833 CAGTTGGTCTGGGGATCAAATGG - Intergenic
1045222356 8:100211545-100211567 CAGCTGCTCTGGAAGCTAAGGGG + Intronic
1046799264 8:118407241-118407263 CAGCTGCTATGGAAATCAACAGG - Intronic
1047241945 8:123098851-123098873 CAACTCCTCTGGAAGTCAACTGG - Intronic
1048213156 8:132473881-132473903 CAGCTGCTCTGGAACATAAAGGG - Intronic
1052043622 9:23769329-23769351 CAGCTGGGTAGGCAGTCAAAGGG + Intronic
1052201250 9:25783900-25783922 CAGTTGTTCTGGAACTTAAATGG - Intergenic
1053168060 9:35858599-35858621 CAGCTGGTGTGGTAGTCATTAGG + Intergenic
1055322015 9:75091446-75091468 CTGGTGGTCAGGAAGTCGAAAGG + Intronic
1058904613 9:109471854-109471876 CAGCTGGTCTGAGAGCCACACGG + Intronic
1059637206 9:116182759-116182781 CAGCTAGGCTGGATGTGAAAAGG - Intronic
1059740041 9:117141287-117141309 CATCTGGCCAGGAAGTCAGAAGG - Intronic
1060126873 9:121055780-121055802 GAGCTGGTCTGGAAGGCCATGGG + Intergenic
1061051443 9:128198265-128198287 CTGCTGGAATGGAAGTCACAGGG - Intronic
1061636672 9:131914973-131914995 CAGCAAATGTGGAAGTCAAATGG + Intronic
1186475265 X:9852350-9852372 CAGGTGGTCTGGGAATCAGAGGG - Intronic
1186660243 X:11662175-11662197 CAGCTTGCCTGCAAGTGAAAAGG + Intronic
1188450266 X:30301407-30301429 CAGCTGGGATGGAAGAGAAAGGG - Intergenic
1193511043 X:82400164-82400186 CAGATGGACTGGAAGCCAGAAGG + Intergenic
1194212620 X:91087306-91087328 CTGCTGGTCTGAAAGACATAAGG - Intergenic
1194596490 X:95865169-95865191 TAGCAGGTAAGGAAGTCAAAAGG + Intergenic
1195464294 X:105163027-105163049 TAGCTGATCTAGAAGTTAAAGGG - Intronic
1196266319 X:113651467-113651489 GAGGAGGTCTGGAAGTCCAATGG + Intergenic
1197232951 X:124026070-124026092 TACCTGGTCTAGAAGACAAAAGG - Intronic
1199931600 X:152529253-152529275 CTGCTGGTTTGAACGTCAAATGG - Intergenic
1201284987 Y:12371131-12371153 CAGGTGGTCTGGATGTGAGATGG + Intergenic
1201318016 Y:12667140-12667162 CAGCTGGTATGAATGTAAAATGG - Intergenic
1201511238 Y:14766207-14766229 CAGCTGTTTTGGTAGTAAAAAGG - Intronic