ID: 1089814196

View in Genome Browser
Species Human (GRCh38)
Location 11:121158004-121158026
Sequence GGTGCGGAAGACGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 65}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089814196 Original CRISPR GGTGCGGAAGACGCCGCCGC CGG (reversed) Exonic
902897046 1:19485896-19485918 GATGCGGAAGGCACCGCGGCTGG + Intergenic
903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG + Exonic
904252734 1:29236591-29236613 GGCGCGGGGGACGCCGCCCCCGG - Exonic
906125173 1:43423125-43423147 GGTGGGGGAAACGCAGCCGCAGG - Exonic
907479666 1:54736800-54736822 GGTGAGAAAGACGCCCACGCTGG - Intronic
907479738 1:54737134-54737156 GGTGAGGAAGACGCCTGCACAGG - Intronic
920704839 1:208243551-208243573 GGCGCGGGAGAAGCCGCCACGGG + Intronic
1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG + Intergenic
1081700054 11:45147032-45147054 GGTCCGGACGGCGCCGGCGCGGG + Intronic
1085322584 11:75583829-75583851 GGTGGGGAAGGGGACGCCGCGGG + Intergenic
1085597140 11:77820546-77820568 GGTGCTGCAGGCGCCGCCGCCGG - Exonic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1092169352 12:6363568-6363590 GGTGCGGCAGAGTCCCCCGCAGG + Exonic
1096749711 12:53751231-53751253 GGTGCGGAAGGCCGGGCCGCAGG - Intergenic
1097232825 12:57522735-57522757 GCTGCCGCAGCCGCCGCCGCAGG - Exonic
1097848635 12:64390484-64390506 CGGGCGGCAGATGCCGCCGCAGG + Exonic
1101605916 12:106247737-106247759 CGTGGCGAAGAAGCCGCCGCCGG - Exonic
1103020601 12:117530981-117531003 GGTGCCGGAGACGCCGACCCGGG - Exonic
1122657764 14:103273642-103273664 GGTGCGGCAGAGGCGTCCGCTGG - Intergenic
1123108821 14:105855751-105855773 GTTGCCGAAGAAGCCGTCGCGGG + Intergenic
1132926093 16:2429719-2429741 GGGCCGGAAAACGTCGCCGCGGG - Intronic
1136630917 16:31488809-31488831 GGTGCGCAAGCCCCCGCCCCGGG - Intronic
1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG + Intronic
1144501078 17:15786899-15786921 GGAGCAGACGTCGCCGCCGCGGG - Intergenic
1144825748 17:18104825-18104847 GGTGCTGCAGACGCAGCCCCAGG - Intronic
1145163245 17:20589573-20589595 GGAGCAGACGTCGCCGCCGCGGG - Intergenic
1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG + Intronic
1152049084 17:77958760-77958782 GGAGCCGTAGCCGCCGCCGCCGG + Intergenic
1152280058 17:79379922-79379944 GGTGCGGGAGAGGCCGCGGCAGG - Intronic
1152455448 17:80413521-80413543 GGTGGGAAAGACACCGCAGCAGG + Intergenic
1156171648 18:34493640-34493662 GGTGCAGAGGAGCCCGCCGCGGG + Intronic
1160454881 18:78993094-78993116 GTTGGGGAAGATGACGCCGCTGG - Exonic
1168489350 19:56795313-56795335 CGTGAGGAAGACTCCGCGGCGGG - Intronic
1202683591 1_KI270712v1_random:30382-30404 GGCGCGCAAAACGCCGCGGCGGG - Intergenic
926243530 2:11105469-11105491 GGTGTGGGAGAGGCAGCCGCCGG + Intergenic
944515703 2:200509951-200509973 GGTGCGGAAGAGCCGGGCGCGGG - Exonic
946426732 2:219602481-219602503 AGAGCAGAAGTCGCCGCCGCAGG - Exonic
949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG + Intergenic
1176187744 20:63790550-63790572 GGTGCAGAAGACGTCGGAGCAGG - Exonic
1184241363 22:43212731-43212753 GGTGGGGAAAACGCAGCAGCCGG + Intronic
1185259550 22:49853935-49853957 GCTGCGGACGACGGCGGCGCGGG - Exonic
959575397 3:107927898-107927920 GGCGGGGAAGAGGACGCCGCCGG + Intergenic
963044887 3:141095107-141095129 GGTGGGGAAGAGGCCGAGGCAGG + Intronic
976774826 4:88697258-88697280 GCTGCGGCAGAGGCTGCCGCGGG - Exonic
985641207 5:1064294-1064316 GGTGCGGAAGGGGCCTCCCCGGG + Intronic
985782445 5:1878300-1878322 GGCGCGGAGGACACAGCCGCAGG + Exonic
992104212 5:73436832-73436854 GGTGAGGAAGGGGCGGCCGCGGG - Intergenic
999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG + Intronic
1001506490 5:172284061-172284083 GGTGCGGAGGGCGGCGCCGCGGG - Exonic
1001995539 5:176154510-176154532 GGTAAGGAAGACGAAGCCGCAGG + Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006316157 6:33293122-33293144 GGTGCAGAAGAGGCCTCCGGGGG - Exonic
1011640359 6:89411960-89411982 GCTGGGGAAGCCGCAGCCGCAGG - Exonic
1014098182 6:117482597-117482619 CGGGCGGGAGACGCCCCCGCAGG + Intronic
1015842231 6:137488396-137488418 GCTGGGGAAGGCGCCGCCCCCGG + Intergenic
1017966459 6:159271097-159271119 GGTGGGGAAGACCCCACCCCAGG + Intronic
1022363375 7:29685054-29685076 GGGCCGGAGGCCGCCGCCGCGGG - Intergenic
1023850804 7:44149301-44149323 GGTGTGGAAGACCCCTCTGCTGG + Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1031966578 7:128031733-128031755 GCTGCGGCCGCCGCCGCCGCCGG - Intronic
1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG + Intergenic
1035369674 7:158372032-158372054 TGTGCGGAAGACCCCCTCGCAGG + Intronic
1035751723 8:2001499-2001521 GGTTCGGGGGACGGCGCCGCGGG - Exonic
1035779519 8:2216764-2216786 GCTGCAGAAGACGGTGCCGCTGG - Intergenic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1047499271 8:125429741-125429763 GGGGCGAAAGGCGTCGCCGCGGG + Intergenic
1049406176 8:142452746-142452768 GGGGCGGAGGACGCCGCAGGAGG - Intronic
1054835654 9:69672553-69672575 GGTGCCGCCGCCGCCGCCGCGGG - Intergenic
1061128317 9:128690084-128690106 GGTGCCGGGGGCGCCGCCGCGGG - Intronic
1062288430 9:135784076-135784098 GATGCTGAAGACGCGGCCGGCGG - Exonic
1062587034 9:137254090-137254112 GGTGCGGGTGACGGCACCGCAGG - Intergenic