ID: 1089814352

View in Genome Browser
Species Human (GRCh38)
Location 11:121159014-121159036
Sequence CACTGTGAGCACAGAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 399}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089814352 Original CRISPR CACTGTGAGCACAGAGAGGC AGG Intronic
900129762 1:1082431-1082453 CCCTCTGAGAACAGTGAGGCTGG - Exonic
900271997 1:1795364-1795386 GAATGTGAGCACAGAAGGGCAGG + Intronic
900487212 1:2928735-2928757 CACTGTGAGAGCAGAGACGCAGG + Intergenic
900523266 1:3116336-3116358 CAGTGTGAGAACCGAGAGCCAGG + Intronic
900594793 1:3475856-3475878 CACTGTGGGCAGCCAGAGGCTGG + Intronic
900778865 1:4604278-4604300 CACTGTAAGCATAGAGAATCAGG - Intergenic
901156808 1:7145710-7145732 GTCTGTGAGCACAGAGGGGCCGG + Intronic
901449161 1:9325655-9325677 CCCTGTGAGAACACAGGGGCTGG - Intronic
901795580 1:11677475-11677497 GACTGTGAGCACACAGGGACGGG + Intronic
902472365 1:16657621-16657643 CAGTGTGAGCTCAGAAAGCCTGG + Intergenic
902486439 1:16749825-16749847 CAGTGTGAGCTCAGAAAGCCTGG - Intronic
902505785 1:16938482-16938504 AGGTGTGAGCCCAGAGAGGCGGG + Exonic
902792691 1:18779705-18779727 GACAGTGAACACGGAGAGGCAGG + Intergenic
904203134 1:28834910-28834932 CACTGTGGGAACATAGAGGAGGG - Intronic
904383072 1:30124557-30124579 AACTGTGACCCCAGAGAGGTGGG - Intergenic
904588538 1:31594017-31594039 CACTGAGAGCAGAGAGAGTGAGG - Intergenic
904595103 1:31639245-31639267 CAGTGTGAACCCAGAAAGGCAGG + Intronic
905395420 1:37663556-37663578 CAGTGTGAGGCCACAGAGGCGGG + Intergenic
906557480 1:46725014-46725036 CACTGAGTGGACAGGGAGGCTGG + Intergenic
906690677 1:47790965-47790987 CACTGTGAGCTAAGAGATGCTGG - Intronic
906788889 1:48641472-48641494 GACTGTGAAGACAGAGAGGAGGG + Intronic
907408722 1:54269981-54270003 CCCTGGGAGCACAGCGGGGCTGG + Intronic
907758783 1:57337528-57337550 CACTGAGAGTACAGAGAGTGGGG - Intronic
907849831 1:58245533-58245555 ATCTGTGAGCACCCAGAGGCAGG - Intronic
909907923 1:81221651-81221673 CACTGTGAGCACTGGGAACCTGG - Intergenic
911539972 1:99146487-99146509 CCCCAAGAGCACAGAGAGGCTGG - Intergenic
912593901 1:110854675-110854697 CACTATGACCACAGTGAGGTGGG - Intergenic
913064753 1:115240347-115240369 CACAGTGAGCACAGAGAGGAAGG - Intergenic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
915021170 1:152779738-152779760 TACTGTGAGCACACAGTGCCTGG - Intronic
915172333 1:153986558-153986580 CATTCTGAGGCCAGAGAGGCTGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915988379 1:160489249-160489271 CACTGTGTCCCCAGATAGGCAGG + Intronic
916197887 1:162241826-162241848 CTCTGTGAACAAGGAGAGGCTGG + Intronic
918076848 1:181177072-181177094 CACTGTGAGCTGGAAGAGGCAGG + Intergenic
920688462 1:208127903-208127925 ACCTGTGGGCACAGAGAGGAGGG - Intronic
920874412 1:209820957-209820979 CACTGAGGGAACAGAGAGGAGGG - Intergenic
921162021 1:212479666-212479688 CACTGGAAGCACACAGATGCTGG + Intergenic
921815332 1:219557060-219557082 CCCTGTGATCACAAAGATGCAGG - Intergenic
922721004 1:227900322-227900344 CAGTGTCAGCCCACAGAGGCTGG + Intergenic
923193808 1:231645001-231645023 CACAGTGAACAGAAAGAGGCTGG - Intronic
923690134 1:236184582-236184604 CAATGTGAGCAAAGAGCGGGTGG + Intronic
1062895341 10:1098619-1098641 TAATATTAGCACAGAGAGGCTGG - Intronic
1063178326 10:3571797-3571819 CACTGGGAGGAGAGAGGGGCAGG - Intergenic
1064297592 10:14092411-14092433 GACTGGGAGCCCAGTGAGGCAGG + Intronic
1065599952 10:27358159-27358181 CACTGGGAGCGGAGAAAGGCAGG + Intergenic
1065600450 10:27362680-27362702 CACTGGGAGCAGAGAAAGGCAGG + Intergenic
1065970144 10:30799552-30799574 CACTGCAGGCACAGGGAGGCAGG - Intergenic
1067556956 10:47279270-47279292 CAAGGTGAGGACAGAGGGGCAGG - Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1068089236 10:52412165-52412187 CACTGTGATCACTGAGAAGTGGG + Intergenic
1068130948 10:52894424-52894446 AAGTGTGAACACAGTGAGGCTGG + Intergenic
1068137597 10:52965779-52965801 CACTGGGAGCAGGGAGAGGCCGG + Intergenic
1068360948 10:55974485-55974507 AAGTGAAAGCACAGAGAGGCTGG - Intergenic
1068398700 10:56499669-56499691 CAGTGTGAACACAGAGTTGCAGG + Intergenic
1068925361 10:62530151-62530173 CAATGAGATCACAGAGAGGTGGG + Intronic
1069422501 10:68260100-68260122 CACTGTGATCACAGAGAGAAGGG + Intergenic
1070048240 10:72861267-72861289 CTCTGGGAGGACAGAGAGGGAGG - Intronic
1070520183 10:77245883-77245905 CACTGAGATAACAGAGAAGCTGG + Intronic
1070624984 10:78044674-78044696 GACTGTGGGCACTGGGAGGCAGG - Intronic
1071917449 10:90310646-90310668 CAATGAGAGCACATGGAGGCAGG + Intergenic
1072417387 10:95260541-95260563 CACTGTGTGCACTGGGAGGAAGG + Intronic
1073042445 10:100616859-100616881 AACTGTGAGCACAGAGGATCAGG + Intergenic
1074861395 10:117512881-117512903 AGCTGTGAGCAGAAAGAGGCTGG - Intergenic
1075408744 10:122211875-122211897 CACTGTGACCGCAGAGAGGAAGG - Intronic
1075717803 10:124566988-124567010 CACTGGGACCCCACAGAGGCAGG + Intronic
1075778821 10:125004135-125004157 AGCTGTGAGGACAGAGGGGCAGG + Intronic
1076917224 10:133430335-133430357 GTCTGTGAGCACAGAGAAGGAGG + Intergenic
1077027239 11:446335-446357 CACTGTCAGCCAAGAGAGGCTGG - Intergenic
1077327657 11:1970668-1970690 CACCTTGGGCACAGAGCGGCTGG - Intronic
1077632365 11:3819398-3819420 GACTGTGAGCGTAGAGAGGAGGG + Intronic
1077785583 11:5380248-5380270 CTGTGTGTGCACAGAGAGTCTGG - Intronic
1077895683 11:6451482-6451504 CACTGTGGGCACAGACAGAAGGG + Intronic
1078421464 11:11216368-11216390 CACTGTGGGCAAAGTGTGGCAGG + Intergenic
1078558119 11:12347253-12347275 CACTGTGGGCACACAGGGGAGGG - Intronic
1079695647 11:23479087-23479109 CACTGTGACAACTGAGAAGCAGG + Intergenic
1081239865 11:40691927-40691949 CACTGTCTCCACAGACAGGCAGG + Intronic
1083288512 11:61676556-61676578 CACTGTGAGCAGACAGGAGCTGG - Intergenic
1083316256 11:61816536-61816558 CACGGTGAGCGCAGCCAGGCGGG - Exonic
1083520075 11:63301722-63301744 CACTGTATGGACACAGAGGCAGG - Intronic
1084727247 11:70949753-70949775 CCTTGGGAGCCCAGAGAGGCTGG - Intronic
1084780420 11:71404623-71404645 ACTTGTGAGAACAGAGAGGCAGG - Intergenic
1084801999 11:71550147-71550169 CACTCTGAGCCCAGAGATGGAGG - Intronic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1086677188 11:89622605-89622627 AACGGTGAGCACAGAGATGATGG - Intergenic
1088231300 11:107676233-107676255 CAATGTTAGCACAGAATGGCTGG + Intergenic
1089146108 11:116330689-116330711 CAGTGTGTGCACAGAGGGGTGGG - Intergenic
1089183889 11:116601864-116601886 CTCTGTGACCATAGAGAAGCTGG + Intergenic
1089637973 11:119828579-119828601 CACTGTGATGACAGAGAGATGGG + Intergenic
1089814352 11:121159014-121159036 CACTGTGAGCACAGAGAGGCAGG + Intronic
1089918052 11:122178715-122178737 CACAGTAAGAAAAGAGAGGCAGG + Intergenic
1090208320 11:124897836-124897858 CACTGTGAGCTCAGAGCAGCAGG - Exonic
1090950132 11:131465719-131465741 CATTGTTAGCACAGACAGACAGG + Intronic
1091173807 11:133541960-133541982 ATCTGTGAGCACAGACATGCAGG - Intergenic
1202810639 11_KI270721v1_random:25848-25870 CACCTTGGGCACAGAGCGGCTGG - Intergenic
1091495009 12:964870-964892 AACTTAGAGCACATAGAGGCTGG - Intronic
1094499275 12:31008023-31008045 CCCTGGAACCACAGAGAGGCAGG + Intergenic
1095959065 12:47822451-47822473 CACTGTGTGGACAGACAGGCAGG - Intronic
1096368521 12:51048645-51048667 CACTGAGAGTACAGAGGGTCAGG - Intronic
1096559299 12:52424345-52424367 CACTGTCAGGAGGGAGAGGCTGG + Exonic
1097337047 12:58395002-58395024 CACTGAGATCACAGACAAGCTGG + Intergenic
1101436256 12:104667326-104667348 CACAGTGAGCTGAGTGAGGCTGG - Intronic
1102198025 12:111038020-111038042 CAGGATGAGCAAAGAGAGGCCGG + Intronic
1102223138 12:111208284-111208306 GATTGTGGGCACAGATAGGCGGG + Intronic
1102780700 12:115562167-115562189 CAATGTCAGCACAGGCAGGCAGG + Intergenic
1102901981 12:116646112-116646134 CACCGTGAGGACAGAGAGGAGGG + Intergenic
1103447518 12:121003921-121003943 CCGTGGGAGCACAGAGGGGCAGG + Exonic
1104401585 12:128480912-128480934 CCCTGTCAGCTCAGAGAGGGTGG + Intronic
1104419946 12:128627035-128627057 CACAGTGAGGACAAAGATGCCGG - Intronic
1104574404 12:129953736-129953758 CCCTGTGTGCACAGAGAGAAAGG - Intergenic
1104587755 12:130061268-130061290 CACTGTGAGCCCTGAGTGGATGG + Intergenic
1104680493 12:130747902-130747924 CTCTGAGGGGACAGAGAGGCTGG - Intergenic
1105643324 13:22288817-22288839 CACTCTGGTCACAGAAAGGCAGG - Intergenic
1105678988 13:22706208-22706230 TGCTGAGAGCAGAGAGAGGCAGG + Intergenic
1107419360 13:40232411-40232433 CACTGTGAGCAAGGAAAGACAGG + Intergenic
1108020708 13:46125122-46125144 CACTGTCTACACAGAAAGGCAGG - Intergenic
1108569453 13:51735069-51735091 CCCTGTGTGCAGAGAGATGCAGG + Intronic
1109960257 13:69619934-69619956 CAATGAGAGAACAGAGAGTCTGG - Intergenic
1110904834 13:80873738-80873760 CACTGACACCACAGAGAGGGTGG - Intergenic
1111876121 13:93898307-93898329 GAATGTGAGCCCACAGAGGCAGG - Intronic
1117088197 14:52223011-52223033 CACTGTGAGCTCCCAGAGCCTGG + Intergenic
1118336134 14:64854888-64854910 TTCTCTGTGCACAGAGAGGCTGG + Intronic
1118821769 14:69350543-69350565 CCATGTGGGCCCAGAGAGGCTGG + Intronic
1119554425 14:75542425-75542447 CACCTAGAGCACAGTGAGGCTGG - Intronic
1119917605 14:78416756-78416778 CACAGTCAGAACTGAGAGGCAGG + Intronic
1120877020 14:89384293-89384315 CAAAGTGAGCACAGTGAAGCAGG - Intronic
1121422386 14:93824763-93824785 AAGTGGGAGCACAGAGGGGCCGG - Intergenic
1121706683 14:96001700-96001722 CACGGAGAGCAAAGAGAAGCAGG + Intergenic
1122139137 14:99651912-99651934 CACTGTTAACACAGAGAGGGTGG + Intronic
1122659778 14:103287521-103287543 CCCCGTGAGTACAGAGAGGGAGG - Intergenic
1125171084 15:36767545-36767567 CACTGTGCAAACAGAGAAGCAGG + Intronic
1125363871 15:38892965-38892987 CACTGTGAACACATAGACACAGG + Intergenic
1125483136 15:40094022-40094044 CACTCTGAGCACAGAGATAATGG - Intronic
1126563209 15:50067433-50067455 CACTGTTAGCAAGGAGAGACAGG - Intronic
1127560108 15:60127785-60127807 CACTGTAAGCCGAGACAGGCTGG + Intergenic
1127816771 15:62617550-62617572 CACAGGGAGCTCAGAGAGGCTGG - Intronic
1127939996 15:63685287-63685309 AACTGGGAGCACAGAGTGGAAGG + Intronic
1128380670 15:67109790-67109812 CACTGACATCACTGAGAGGCCGG - Intronic
1128755818 15:70182994-70183016 CCTTGTCAGCACAGAGAAGCTGG - Intergenic
1129825050 15:78629348-78629370 CACATTGAGCACACAGACGCTGG + Exonic
1131177309 15:90218072-90218094 CACTGTAAGCCCAGTGAGACCGG - Intronic
1131575937 15:93591007-93591029 CTGTGTGAGCATAGAGAGACGGG - Intergenic
1131597443 15:93812909-93812931 CACGCTGAACACAGATAGGCTGG - Intergenic
1132735528 16:1384075-1384097 CACTGTCAGGACAGAGAGGCAGG + Intronic
1133046303 16:3090124-3090146 CACTCTGCGCACAGGAAGGCGGG + Exonic
1133104759 16:3500257-3500279 CACTGTGGGCGCCCAGAGGCAGG - Intergenic
1134334592 16:13286244-13286266 CACGCTGAGCACATATAGGCAGG + Intergenic
1134847874 16:17456104-17456126 CACTCTGTGCACACAGAGGATGG + Intronic
1134882041 16:17753464-17753486 CCCTGTGGGGACAGAGAGACAGG + Intergenic
1135059931 16:19262802-19262824 CACAGTTAGCACAGACAAGCTGG + Intronic
1136997683 16:35201958-35201980 CACTGTGGGCACAGGTGGGCAGG - Intergenic
1137369172 16:47888786-47888808 CACTGGGAGCACACAGAGCAAGG - Intergenic
1137557243 16:49478395-49478417 CACTGATACCACAGAGGGGCAGG - Intergenic
1137869664 16:51937841-51937863 TGCTGTGAGCACAGACAGGAAGG + Intergenic
1138539147 16:57678035-57678057 GACTGTCAGCTCTGAGAGGCAGG - Intronic
1140017783 16:71205297-71205319 CACGCTGAGCCCAGACAGGCTGG - Intronic
1141523162 16:84594825-84594847 CACTGAGAAGAGAGAGAGGCTGG - Intronic
1141698608 16:85632332-85632354 AAATGAGAGAACAGAGAGGCGGG - Intronic
1142382002 16:89738201-89738223 CTCTGTGACCACAGAGGGCCAGG + Exonic
1143163347 17:4885462-4885484 CACTGTGAAGACACAGAGGGAGG - Exonic
1144334327 17:14255416-14255438 CACCGTGGGAACAGAGAGCCAGG - Intergenic
1146637904 17:34519612-34519634 CCCTGCAAGCACAGCGAGGCTGG + Intergenic
1146676520 17:34777097-34777119 TACACTGAGCAGAGAGAGGCAGG - Intergenic
1147563313 17:41521968-41521990 CACTGTGCACACACAAAGGCAGG + Exonic
1147980143 17:44269069-44269091 CGCTCTGGGCACAGAGAGGAGGG + Intergenic
1148643641 17:49206518-49206540 CACTCTGAGGACAGTGTGGCTGG - Exonic
1148860536 17:50602214-50602236 GGGTGTGAGCACAGAGAGGAGGG - Intronic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1151661208 17:75519295-75519317 GTGTGTGAGCACTGAGAGGCAGG + Intronic
1151851357 17:76692028-76692050 CCTCCTGAGCACAGAGAGGCTGG + Intronic
1152343975 17:79740463-79740485 GCCCCTGAGCACAGAGAGGCAGG - Intronic
1152539095 17:80965931-80965953 CCCTGTGAGCTGAGTGAGGCCGG - Exonic
1152760510 17:82104936-82104958 AACTCTGAGCACAAAGAGGACGG + Intronic
1152800571 17:82328878-82328900 CACTGGGAGCTGGGAGAGGCAGG - Intronic
1153215007 18:2811300-2811322 CACTGTGTCCAAAGAGAGACAGG - Intergenic
1153678288 18:7475818-7475840 CACCGTGAGGTCAGAGACGCAGG - Intergenic
1155160289 18:23189889-23189911 CAGAGTGAGCACAGACAGCCTGG + Intronic
1155166294 18:23235103-23235125 CACTGTGACCACAGAGCCCCAGG + Intronic
1156308732 18:35903929-35903951 CACTGTGAACACCATGAGGCTGG + Intergenic
1157223340 18:45842164-45842186 CACGGTGAGCACATGGTGGCTGG - Exonic
1157251158 18:46097545-46097567 CACTGTGACAACAGTGAAGCTGG - Intronic
1157654272 18:49369926-49369948 CTCTGTGAGCACTGAGGGGAGGG - Intronic
1157690450 18:49677628-49677650 AAATGGAAGCACAGAGAGGCTGG - Intergenic
1158343795 18:56494184-56494206 CACAGTGAGCAAAGAGGGGTGGG - Intergenic
1159529769 18:69640594-69640616 CCCTGGGGGCACAGAGAGACAGG + Intronic
1159893909 18:73978855-73978877 CAGGGTGAGCACAGAGAGCTAGG + Intergenic
1160399942 18:78602734-78602756 CAGGGCGTGCACAGAGAGGCAGG + Intergenic
1160596273 18:79976607-79976629 AACTGTGAGCTCAGAAAAGCGGG + Intronic
1160810673 19:1011662-1011684 CACTGCGGGCACAGGGCGGCGGG + Exonic
1162695402 19:12469828-12469850 CACTGTTAGCACACATAGGATGG + Intronic
1163255785 19:16154999-16155021 GACTGTGAGCTCTGAGAGACTGG + Intronic
1163603947 19:18264236-18264258 CACAGTGACCACAGATAAGCAGG + Intronic
1163862642 19:19750206-19750228 CCCCGTGAGAACTGAGAGGCAGG + Intergenic
1164563270 19:29308654-29308676 GGCTGAGGGCACAGAGAGGCAGG + Intergenic
1164563358 19:29309139-29309161 GACTGAGGGCACAGAGAGGCAGG + Intergenic
1164563371 19:29309200-29309222 GGCTGAGGGCACAGAGAGGCAGG + Intergenic
1164794649 19:31015867-31015889 CACAGGAAGCACAGAGAGGGTGG + Intergenic
1164821838 19:31256746-31256768 CACTGTGAGGACAGGCGGGCAGG - Intergenic
1165060811 19:33204451-33204473 CAGTGTGGGGACAGAGTGGCTGG + Intronic
1165106586 19:33473411-33473433 TCCTGTGCACACAGAGAGGCCGG + Intronic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1166324680 19:42041992-42042014 CACTGTGAGCACAGTGGATCTGG - Intronic
1166357693 19:42236745-42236767 CACTGTGAGAAGAGTGAGGAGGG + Intronic
1166752346 19:45170313-45170335 CGCTGTGAGCATAGTGAAGCCGG - Intronic
1167489946 19:49786795-49786817 CACTTTGAGGACTGAGAGGGAGG + Intronic
1167750032 19:51373790-51373812 CACTGTCTTCACAGAGTGGCAGG - Intergenic
1167798099 19:51723979-51724001 CTCTCTGGCCACAGAGAGGCTGG - Intronic
1168329834 19:55561290-55561312 AAGTGTGAGCACTGGGAGGCAGG + Intergenic
924983403 2:244952-244974 CACTGAGACCACGGAGGGGCTGG - Intronic
925113787 2:1360344-1360366 CACTCTGAGGGCAGAGAGGGAGG - Intronic
925338166 2:3113982-3114004 CACTGTGAAGAAAGAGAAGCTGG + Intergenic
926240305 2:11080348-11080370 GACAGAGAGCACAGTGAGGCTGG + Intergenic
927005590 2:18844651-18844673 CATTGTGACCCCAGAGAGCCAGG - Intergenic
927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG + Intergenic
927888190 2:26731138-26731160 CAGTGTGAAGACAGATAGGCAGG - Exonic
928171207 2:29003923-29003945 CACTGGGAGAAGACAGAGGCTGG - Intronic
928213471 2:29341422-29341444 CACAGTGAGTAGCGAGAGGCTGG + Intronic
928855779 2:35801052-35801074 GCCTGTGAGAATAGAGAGGCAGG + Intergenic
929795082 2:45053131-45053153 TACTCTGACCACAAAGAGGCAGG - Intergenic
930713612 2:54572491-54572513 CACTCTGAGCAAATAGAGGCTGG + Intronic
931251431 2:60534197-60534219 CACTGGGAGCCCAGGGAGCCTGG + Intronic
931308384 2:61055004-61055026 CACTTTGGGGGCAGAGAGGCAGG - Intergenic
931864964 2:66399600-66399622 CACTGTGACCATAGAAAGGCAGG + Intergenic
932915715 2:75855964-75855986 CTCTGTGAGGACAGTGAGGAAGG + Intergenic
933199155 2:79428897-79428919 CACTGGGATCATTGAGAGGCTGG - Intronic
934077333 2:88439310-88439332 CAGTGGGAGCAAAGAGGGGCTGG - Intergenic
934520945 2:95019829-95019851 CTCTGCGAGCACAGGGAGCCAGG - Intergenic
934972638 2:98775350-98775372 CACTGTGTTCTCAGGGAGGCAGG + Intergenic
935237659 2:101151636-101151658 CCCTGAGAGCGCGGAGAGGCGGG - Intronic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
937318302 2:120946002-120946024 CAGTGTGTGCAAAGAAAGGCTGG - Intronic
937508401 2:122563534-122563556 TACTGTGAGAACAAAGAGGAGGG + Intergenic
938195460 2:129323628-129323650 CACTGTAAGCAAAGAGAAGAGGG + Intergenic
939023955 2:136989702-136989724 CAAGATGAGCTCAGAGAGGCTGG + Intronic
939787614 2:146537104-146537126 CACTATGAGAAGAGATAGGCCGG + Intergenic
941750184 2:169127309-169127331 CAATATTAGCACAGAGAGTCAGG + Exonic
943088755 2:183349232-183349254 CTGTGTGGGCACAGAGAGCCTGG - Intergenic
944528150 2:200641338-200641360 AAGTGTGAGCCCAGAGATGCTGG + Intronic
944674302 2:202022342-202022364 CAATGAGAGCACATGGAGGCAGG + Intergenic
944934545 2:204554211-204554233 TACTGTAAGCAGAGAGAGACAGG - Intronic
945285174 2:208074924-208074946 CACAGGAAGCACAGAGAGGCGGG - Intergenic
945395953 2:209317800-209317822 CCCTGTGACCACAGGGAGGGAGG - Intergenic
946431252 2:219628230-219628252 CTCTGGGAGCCCAGAGAGGGTGG + Intronic
946732626 2:222723942-222723964 AAGTGTGAGCCCAGAGAGGGCGG - Intergenic
946884363 2:224208348-224208370 CAGTGTGAGCAAGGAGAGGTTGG + Intergenic
947015938 2:225619670-225619692 CACAGACAGCATAGAGAGGCAGG + Intronic
947432314 2:230041891-230041913 CACTGTGGGCTCAGAGTGACTGG - Intronic
947670141 2:231930610-231930632 CCCTCAGAGCACACAGAGGCCGG + Intergenic
947900096 2:233714050-233714072 CACTGAGAGGAAGGAGAGGCAGG + Intronic
948658570 2:239492230-239492252 CACTGGGAGCAGGAAGAGGCAGG - Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
1168970394 20:1926864-1926886 CACTGTGAGCATTGAGAGGCTGG - Intronic
1169608504 20:7351366-7351388 CACTGAGATGACAGAGAGGAAGG - Intergenic
1169610180 20:7370542-7370564 CAATGTGAGCACATAGACACAGG + Intergenic
1172877675 20:38175768-38175790 AGCTGTGGGCACAGAGAGGTAGG + Intergenic
1173846848 20:46193699-46193721 CATTCTGAGAACAGAGAGGCTGG - Intronic
1174339961 20:49889360-49889382 CACTGTGTCCCCAGAGAAGCAGG - Exonic
1174466695 20:50723295-50723317 CAAGGTGAGGACAGTGAGGCAGG - Intergenic
1175274825 20:57761148-57761170 CACTGTGAGGCCAGGGTGGCAGG - Intergenic
1175334246 20:58184830-58184852 CAATGGAAGCAGAGAGAGGCTGG + Intergenic
1175368401 20:58470821-58470843 CACTGTGGCCACAGAGAGCCAGG + Intronic
1175893154 20:62324155-62324177 CACTGTGAGCGCTGCCAGGCTGG - Exonic
1178308431 21:31509634-31509656 CACAGAGAGGAGAGAGAGGCAGG + Intronic
1179312992 21:40213358-40213380 CTATGTGTGCACAGGGAGGCAGG - Intronic
1179511370 21:41876333-41876355 AAATGCGAGCACAGAGAAGCTGG + Intronic
1179572677 21:42287134-42287156 CACAGGGAGGACACAGAGGCAGG + Intronic
1179887043 21:44318683-44318705 CACTGTGAGCACCGGAGGGCAGG + Intronic
1179920379 21:44504126-44504148 CACTGTGGGCTCACTGAGGCCGG - Intronic
1179920477 21:44504477-44504499 CACTGTGGGCTCACCGAGGCCGG - Intronic
1179920491 21:44504524-44504546 CACTGTGGGCTCACCGAGGCCGG - Intronic
1179920503 21:44504571-44504593 CACTGTGGGCTCACCGAGGCCGG - Intronic
1179920515 21:44504618-44504640 CACTGTGGGCTCACCGAGGCCGG - Intronic
1179920527 21:44504665-44504687 CACTGTGGGCTCACCGAGGCCGG - Intronic
1179920539 21:44504712-44504734 CACTGTGGGCTCACCGAGGCCGG - Intronic
1179948925 21:44698678-44698700 CCCTGTGAGGACTGAGGGGCTGG - Intronic
1181015960 22:20068907-20068929 AACTGTGAGCACAAAGACCCTGG - Intergenic
1181343650 22:22201589-22201611 CTCTGTGAGCCCAGTGACGCTGG + Intergenic
1181939205 22:26462367-26462389 CAGTGGGGGGACAGAGAGGCTGG + Intronic
1182691128 22:32164230-32164252 CACCCTGAGCACAGAGATGCAGG + Intergenic
1182716467 22:32359731-32359753 CAATGTGATGACAGAGATGCTGG - Intronic
1184812359 22:46844762-46844784 CGGTCTGAGCACAGTGAGGCTGG + Intronic
949140852 3:630806-630828 TACTGTGAGCATGGAAAGGCAGG + Intergenic
949645524 3:6089210-6089232 CACCATGAGCACAAAGATGCAGG - Intergenic
950560420 3:13718264-13718286 CCAGGTGAGCACATAGAGGCAGG - Intergenic
951530555 3:23694441-23694463 CACTGTGGACACAGAGGGGCAGG - Intergenic
952959390 3:38580094-38580116 CTCTGGGACCACAGGGAGGCAGG + Intronic
953440628 3:42913746-42913768 CACTATGAGAACAAAGAGGAGGG + Intronic
954395165 3:50289627-50289649 TCCTAGGAGCACAGAGAGGCAGG + Exonic
955010730 3:55012049-55012071 GACTGTGAGCTCTGAGAGGCCGG + Intronic
956848962 3:73210868-73210890 CATTAGGAGCAGAGAGAGGCAGG + Intergenic
957417767 3:79929004-79929026 CCCTGAGAGCACAGGGATGCTGG - Intergenic
958712381 3:97732996-97733018 CACTGTCCCCACAGAGAGGCCGG + Intronic
958985067 3:100770804-100770826 CACGGTGACCACAGTGAGGTTGG + Exonic
960846085 3:122005713-122005735 CCATGGGAGCAGAGAGAGGCTGG - Intronic
960889148 3:122428328-122428350 CAAGTTGAGTACAGAGAGGCAGG + Intronic
961513375 3:127418145-127418167 CCTCGTGAGCACAGAAAGGCGGG + Intergenic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
961838187 3:129682512-129682534 CACTGTAGGCTCAGGGAGGCAGG - Intronic
962321273 3:134392640-134392662 CACTGTGCTCAGAGTGAGGCTGG - Intergenic
962473316 3:135732511-135732533 CACACTGAGCCCAGACAGGCTGG + Intergenic
962786685 3:138775183-138775205 CACAGAGAGTCCAGAGAGGCAGG + Intronic
964858755 3:161176625-161176647 CACTGTGAGAACAGTGATGGTGG + Intronic
964940787 3:162156557-162156579 AAGTGAGAGCAAAGAGAGGCTGG + Intergenic
966568964 3:181418582-181418604 CTGTGTCAACACAGAGAGGCTGG + Intergenic
967612053 3:191518831-191518853 CACTGTGAGCCAAGAAAGGAAGG + Intergenic
968266494 3:197367311-197367333 CACTGTGACCACATAGCTGCGGG + Intergenic
968648371 4:1750782-1750804 CACTGTGGGCACAGGGGGGTCGG - Intergenic
968654321 4:1772047-1772069 GTCTGTGTGCACAGAGGGGCCGG - Intergenic
969122195 4:4918892-4918914 CTCTGTGAGCAGAGAGACGGGGG + Intergenic
969527175 4:7709800-7709822 CACTGTGGGGAAAGAGAGGCAGG - Intronic
969695206 4:8730329-8730351 CTCTGTGATCAGAGAGAGGCCGG + Intergenic
969702046 4:8773161-8773183 TCCTGAGAGCAGAGAGAGGCGGG + Intergenic
970067550 4:12116216-12116238 CACTGTGATCTCAGGGAAGCAGG + Intergenic
970349306 4:15185392-15185414 TACTGTGAGCCCAGAGAGACAGG - Intergenic
972591527 4:40492693-40492715 CACTGTGAGAACAAAGAGCTGGG - Intronic
972671803 4:41219584-41219606 GACAGTGAGGACAGAGAGGCAGG - Intergenic
972824140 4:42736986-42737008 CACAGTGAGCTCAGAGGAGCAGG - Intergenic
974240952 4:59246236-59246258 CACTCTGAGAGCAGAGAGGATGG + Intergenic
975609068 4:76186141-76186163 CACTGTGGGCATACAGAGGAGGG + Intronic
977588523 4:98801627-98801649 CACAGTGTGCACAGAGTGGCTGG - Intergenic
980761871 4:137245097-137245119 ATCAGAGAGCACAGAGAGGCTGG - Intergenic
983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG + Intronic
983816670 4:172137789-172137811 AACTGCAAGAACAGAGAGGCAGG + Intronic
983916742 4:173300636-173300658 CATGGTGAGCCCAGAGAGCCGGG + Intronic
984135700 4:175935337-175935359 AACTTTGAGGAAAGAGAGGCAGG + Intronic
987078758 5:14407470-14407492 CACTATGAACCCAGAGAAGCTGG - Intronic
987583404 5:19824345-19824367 CATGGTGAGCCCAGACAGGCTGG - Intronic
987937284 5:24482363-24482385 CAGTGTGAACACAGGAAGGCAGG + Intergenic
988576996 5:32436067-32436089 TACTGTGTGAACAGAGAGCCAGG - Intronic
988833375 5:35008348-35008370 GACTTTGAGCACACAGAGGTTGG + Intronic
989458458 5:41668932-41668954 CAATGTGAGATCAGAAAGGCAGG - Intergenic
992713113 5:79481359-79481381 CACCGTGATCTCTGAGAGGCAGG + Intronic
996412268 5:123171114-123171136 CACTGTCAGCAGTGAGAGTCAGG - Intronic
996988892 5:129604051-129604073 CAGTGAGAGCACATAGAGACAGG + Intronic
998135835 5:139674067-139674089 CACTGCGAGCACCCAGAGGGTGG - Intronic
998280049 5:140797087-140797109 CACCGTGAGCACCAACAGGCTGG - Exonic
998337709 5:141388109-141388131 CACCGTGAGCGCAGAGAGCGGGG + Exonic
998338819 5:141398352-141398374 CACCGTGAGCGCAGAGAGCGGGG + Exonic
999098180 5:148999889-148999911 CACTCTGAGTGCAGTGAGGCTGG - Intronic
1000532659 5:162443417-162443439 AAATTTGAACACAGAGAGGCTGG - Intergenic
1001131730 5:169069810-169069832 CACCATGAGAACAGAGAAGCAGG + Intronic
1001568180 5:172713910-172713932 AACTGTGAGGACAGTGAGGCGGG + Intergenic
1001686007 5:173595639-173595661 CTCCGAGAGCACAGAGAGGCAGG + Intergenic
1002213099 5:177609900-177609922 CACAGTGATCAGAGAGAGGCTGG + Exonic
1002336712 5:178484520-178484542 AACTGTAAGAACAGTGAGGCCGG + Intronic
1002419017 5:179135890-179135912 CAGGGTGAGTACACAGAGGCCGG - Exonic
1002861817 6:1086171-1086193 GCCTGTGATCTCAGAGAGGCTGG - Intergenic
1003505417 6:6736534-6736556 CCCTGTGAGCCCATAGAGGCTGG - Intergenic
1005268423 6:24137789-24137811 TACTGGGAGCACAGAGGGGCAGG + Intronic
1005849546 6:29811413-29811435 CCCTGTGAACACAGGGAGTCAGG + Intergenic
1005861384 6:29905344-29905366 CCCTGTGAACACAGGCAGGCAGG + Intergenic
1005910224 6:30303020-30303042 CACTGTCCCCACAGAGTGGCTGG + Intergenic
1005917372 6:30364987-30365009 GATTGTGACCACAGAGAGCCTGG - Intergenic
1006347844 6:33497843-33497865 CTCCAAGAGCACAGAGAGGCTGG - Intergenic
1006463902 6:34179516-34179538 CCCTGAGAGCACAGGGATGCTGG + Intergenic
1006733248 6:36252426-36252448 CACGGAGGGGACAGAGAGGCGGG + Intronic
1006934882 6:37710382-37710404 CTGGGTGAGCACAGAGAGGGAGG - Intergenic
1007282068 6:40720222-40720244 CAGTGTGATCACAGAGAGAGAGG + Intergenic
1007736114 6:43983307-43983329 CACTGTGAGCAGAGGGACTCAGG - Intergenic
1009939424 6:70272521-70272543 AACATTCAGCACAGAGAGGCAGG + Intronic
1009961484 6:70527967-70527989 CACTGTATGCACAGAAAAGCTGG - Intronic
1010291053 6:74138394-74138416 CACTGTGATCATAGAGAAGCAGG - Intergenic
1013346093 6:109262180-109262202 CTCTGGGAGCAGAGAGGGGCAGG - Intergenic
1013731684 6:113175653-113175675 CAATGTGAGGTCAGAGAGGATGG + Intergenic
1015824781 6:137300116-137300138 CACTGAGTGCACAGAGATCCTGG + Intergenic
1016452173 6:144194631-144194653 AACTGGGAGCAAACAGAGGCTGG + Intergenic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1017854735 6:158340424-158340446 CCCTGTGTGCACACAGAGGAGGG - Intronic
1017971343 6:159315168-159315190 CACCCTGAGCTCAGGGAGGCAGG - Intergenic
1018843904 6:167540786-167540808 GGCTGTGCTCACAGAGAGGCTGG + Intergenic
1018982777 6:168613350-168613372 CAGTGTGAGGACAGAGGGGGCGG + Intronic
1019031712 6:169018972-169018994 CACAGTGAGCCCAGACAGGCTGG + Intergenic
1019033698 6:169035523-169035545 CAATGTGTGCACAGAAAAGCCGG + Intergenic
1019094509 6:169567882-169567904 CACTGTGTTCCTAGAGAGGCTGG + Intronic
1019182841 6:170202630-170202652 CACTGTAAGCTCAGGGAGGGCGG - Intergenic
1019729574 7:2622736-2622758 CCCTGTGAGCACAGAAAGGCTGG - Intergenic
1021202831 7:17744392-17744414 CAGTGTGAGAACAGACAGGGGGG + Intergenic
1021848010 7:24781172-24781194 CAGTGTGACCACAGACAGGCAGG + Intergenic
1022447579 7:30482517-30482539 AAGTGAGAGCAAAGAGAGGCTGG - Intergenic
1022744267 7:33154019-33154041 CAATGTGAGCACATAGATGAGGG - Intronic
1024001048 7:45189570-45189592 CTCTGTTCACACAGAGAGGCCGG + Intergenic
1028607505 7:92671252-92671274 CACTGTAAGCACTGAGAAGGCGG + Intronic
1029438427 7:100574877-100574899 CACCGTCAGCACTGAGAGGTGGG + Exonic
1029571651 7:101373716-101373738 AAGTGTGAGCACATAGAGGAGGG + Intronic
1033217741 7:139505843-139505865 CACTGTGAGCACACAGCTGATGG - Intergenic
1034697488 7:153066759-153066781 CACTGAGAGCAGAGAGAACCTGG + Intergenic
1035332982 7:158108266-158108288 CAATGGGAGCACAGAGATCCAGG - Intronic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035472271 7:159118050-159118072 CACGGGGAGCTCAGAGAGGCCGG + Intronic
1036001146 8:4606408-4606430 CACTGTGAGCCCAGGGAGCCAGG - Intronic
1038553781 8:28492152-28492174 CACTGTGAACACAGACAGTGTGG - Intergenic
1040538416 8:48329837-48329859 AAATGGAAGCACAGAGAGGCTGG - Intergenic
1041383439 8:57276036-57276058 CACTGTCTCCACTGAGAGGCTGG - Intergenic
1042903953 8:73754541-73754563 CACTGGATGCACAGAGAGGATGG - Intronic
1043231031 8:77800845-77800867 GACTGAGAGCCAAGAGAGGCTGG - Intergenic
1043400481 8:79879583-79879605 CAGGGTGAGCATAGAGAGGTGGG + Intergenic
1044254147 8:90040081-90040103 ACCTCTGAGCACAGAGAGGATGG + Intronic
1044612898 8:94112105-94112127 CACTCTGAGCTCATTGAGGCAGG - Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1045578980 8:103457687-103457709 TACTGTGAGTTAAGAGAGGCAGG - Intergenic
1045676736 8:104615387-104615409 CACACTGAGCCCAGACAGGCTGG + Intronic
1046693807 8:117315944-117315966 CTCTGTAAGCACTGAGAGGCTGG - Intergenic
1047537357 8:125732030-125732052 TACAGTGAGCACTGAGAGGAGGG + Intergenic
1047995757 8:130333925-130333947 CACAGTGTGCACAGAGCAGCTGG + Intronic
1048938577 8:139377241-139377263 CAACGGGAGCCCAGAGAGGCTGG - Intergenic
1049409431 8:142465861-142465883 CCCGGAGAGCACAGAGGGGCAGG + Intronic
1049411705 8:142476515-142476537 CACTGTGGCCACAGAGAGAGAGG + Intronic
1049806709 8:144544288-144544310 TGCTGTGGGCACACAGAGGCAGG - Intronic
1050043315 9:1518113-1518135 CACAGTAAGAACAGAGAGTCTGG - Intergenic
1050170325 9:2809112-2809134 GACTCTGAGCATAGAGGGGCAGG + Intronic
1050643146 9:7690840-7690862 CACTGATAGCAGGGAGAGGCAGG - Intergenic
1050939770 9:11443724-11443746 CTGTGTCAGCACTGAGAGGCTGG + Intergenic
1051141507 9:13984394-13984416 CCCTGTGAGCACAAAGCAGCTGG + Intergenic
1051545381 9:18268537-18268559 CATTGTCAGCCCAGAGAGGATGG - Intergenic
1056841901 9:90004553-90004575 CCCTGTGGGCACAGAGAGTCAGG - Intergenic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1058323813 9:103670053-103670075 CACAGTGAGCTTAGAGAAGCTGG + Intergenic
1059362191 9:113753611-113753633 CACTGGGAGCAACCAGAGGCAGG - Intergenic
1060423102 9:123483467-123483489 GACTGTCTGCACACAGAGGCTGG - Intronic
1060741325 9:126099475-126099497 TACAGTGAGGACAGAGAGGATGG - Intergenic
1061511972 9:131067136-131067158 CACTGTGAGCACTGTCAGGAAGG + Exonic
1061609179 9:131735018-131735040 CGCTGGGAGCACAGAGAGGAAGG + Intronic
1061909171 9:133713714-133713736 GACTGTGGCCACAGAGAGCCAGG - Intronic
1061938854 9:133873401-133873423 CACCGTGAGCACAGTGGGACTGG - Intronic
1061997440 9:134193613-134193635 CAAGGTGAGCACGGTGAGGCAGG + Intergenic
1062036057 9:134383081-134383103 CACTGTGGGGACAGACAGGGTGG + Intronic
1062207080 9:135343132-135343154 AGCTGCCAGCACAGAGAGGCTGG + Intergenic
1062491055 9:136805105-136805127 CACTGTGAGCACTGTGGGCCCGG - Intronic
1062635925 9:137491765-137491787 CACTGTGTGAACACAGACGCAGG + Intronic
1062728672 9:138096211-138096233 CAATGTGATCACAGAGAGGAAGG + Intronic
1186328276 X:8504051-8504073 CACTGTGAGCACAAAGTTCCTGG - Intergenic
1186506011 X:10092818-10092840 CACGGTGGCCTCAGAGAGGCCGG - Intronic
1186509053 X:10117048-10117070 CCCTGTGAGCACGGAAAGGGTGG - Intronic
1187121165 X:16407687-16407709 CAATGTGGGCACAGTGAGGAAGG + Intergenic
1187532395 X:20108918-20108940 AATTGTGGGCACAGAGAGGATGG + Intronic
1187775933 X:22757434-22757456 ATCTGTGAGCACCTAGAGGCAGG + Intergenic
1190120754 X:47657538-47657560 CCCTGTGGGCTCAGAGGGGCGGG + Intronic
1190605904 X:52141884-52141906 CACTGAGAGAACAGAGAAGCAGG + Intergenic
1192257218 X:69471884-69471906 GACTGTGAGCTCAGAGACTCTGG - Intergenic
1192550708 X:72051498-72051520 CACTGTGAGAACAGAGTGGGAGG - Intergenic
1192553038 X:72069213-72069235 CACTGAGAGCAGAGACAGCCAGG + Intergenic
1193082983 X:77423800-77423822 CACTGTGAGAACATAGAGAAGGG + Intergenic
1196843881 X:119883005-119883027 CACTGTGAGAACCGAGTGCCTGG + Intergenic
1196950069 X:120868232-120868254 CACTGTGAGAAAAGGGAGGAAGG - Intergenic
1198827117 X:140711128-140711150 CACTGGAAGCACAGAGAGGAAGG - Intergenic
1199770699 X:150973502-150973524 CACTCTGGGGACATAGAGGCAGG - Intergenic
1200310418 X:155071602-155071624 CGCTCTGAGCACAGAGAAGGAGG + Exonic
1202102642 Y:21326658-21326680 CACTTTAAGCACAGAGAGTTAGG + Intergenic