ID: 1089817422

View in Genome Browser
Species Human (GRCh38)
Location 11:121188987-121189009
Sequence AGAGCCACTGCCTCTTTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089817419_1089817422 -3 Left 1089817419 11:121188967-121188989 CCTCCATAATGCTTGAGGCCAGA 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1089817422 11:121188987-121189009 AGAGCCACTGCCTCTTTTAGAGG 0: 1
1: 0
2: 0
3: 14
4: 142
1089817420_1089817422 -6 Left 1089817420 11:121188970-121188992 CCATAATGCTTGAGGCCAGAGCC 0: 1
1: 0
2: 0
3: 15
4: 101
Right 1089817422 11:121188987-121189009 AGAGCCACTGCCTCTTTTAGAGG 0: 1
1: 0
2: 0
3: 14
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089817422 Original CRISPR AGAGCCACTGCCTCTTTTAG AGG Intronic
900938897 1:5784970-5784992 AGAGCCCCAGCCACTTTCAGGGG + Intergenic
902175018 1:14642897-14642919 AGAGCTACTGGATCTTTTATAGG + Intronic
902401016 1:16156801-16156823 TGAACCACTGCTTCTTTTTGGGG + Intergenic
902692887 1:18121256-18121278 AGTGCCATTGCCACTTTTAGAGG + Intronic
904280640 1:29415959-29415981 GGAGCCACTGCAGCTTTAAGAGG + Intergenic
905201652 1:36320566-36320588 GGAGCCACTTCCTCTTTAGGGGG - Exonic
908150566 1:61297312-61297334 AATGGCACTGCCTCTTATAGAGG - Intronic
908653926 1:66367545-66367567 AGGGCCACTGCTTCTCTAAGAGG + Intronic
909047475 1:70727883-70727905 AGACAGACTGCCTCTTTAAGTGG - Intergenic
912737400 1:112162052-112162074 AGAGCCACTGACTCCTGCAGTGG - Intergenic
915145973 1:153795863-153795885 AGAGCCTCTGATTCTTTTAGGGG + Intergenic
917632212 1:176901578-176901600 ACAGCCACTGCCTTTTTTGCTGG - Intronic
920611643 1:207445045-207445067 AGAGGAACTGCTTCCTTTAGGGG - Intergenic
924749343 1:246871108-246871130 TGAGCCACCACCTTTTTTAGTGG - Intronic
1074872443 10:117587801-117587823 ACAGCCACTGCCTCTTCAAGAGG + Intergenic
1076516910 10:131050922-131050944 AAACCCACTGACTCTTTTTGTGG - Intergenic
1077887601 11:6397204-6397226 AGGCCCTCTGCCCCTTTTAGTGG + Intronic
1079340482 11:19607422-19607444 AGAGGCACTGCCTTTCTAAGTGG + Intronic
1080258529 11:30320939-30320961 AGAGCCACTGCCTCACTTGATGG + Intergenic
1081004378 11:37716566-37716588 ATAGCAACAGCATCTTTTAGGGG - Intergenic
1081160905 11:39747075-39747097 AGAGTCACTTACTCTTTTTGAGG - Intergenic
1081488747 11:43550634-43550656 AGAGCCACTGCATGTTTCTGAGG - Intergenic
1083235669 11:61349308-61349330 GGAGCCACTGCCACCTTCAGAGG - Exonic
1083849294 11:65355650-65355672 CTAGCCACTTCCTCTTTCAGCGG + Intronic
1084170934 11:67400834-67400856 AGAGCAACTACCTCTTTCTGGGG - Exonic
1084712236 11:70851016-70851038 AGAGCCACAGCCACTGTTAATGG - Intronic
1085160996 11:74345016-74345038 AGAGCCACTGCTTGTTTTTTTGG + Intronic
1086527453 11:87744798-87744820 AGAGCTGCTGCCTCATTTTGGGG + Intergenic
1088598612 11:111457248-111457270 TGAGCCACTGCCTTGTTTGGGGG - Intronic
1089628926 11:119771387-119771409 AGGGCCAGTTCCTCTTTTAAGGG + Intergenic
1089817422 11:121188987-121189009 AGAGCCACTGCCTCTTTTAGAGG + Intronic
1092934479 12:13347785-13347807 AGAGCCAATGCATCAATTAGGGG + Intergenic
1097507153 12:60488270-60488292 AGTGACACTGACTCTATTAGAGG - Intergenic
1099080923 12:78179454-78179476 AAAAGCACTGCCTCTTTTAAAGG - Intronic
1099086943 12:78257597-78257619 AGAGACACTGCCTCCTTAAGTGG - Intergenic
1103151267 12:118641073-118641095 AGAGCCCATGACACTTTTAGGGG + Intergenic
1103272126 12:119682017-119682039 AGGGACACGGCCTCTTTTAGTGG - Intergenic
1108330018 13:49377040-49377062 TGAGCCACTGCTTCTGTTGGGGG + Exonic
1110975768 13:81832196-81832218 AGAGCCACCGCCACTTTCAAAGG + Intergenic
1113138727 13:107122879-107122901 ATTGCAACTGCCTCTTTTTGAGG - Intergenic
1115496659 14:34011583-34011605 AGGCCCACTGCCTCCTTTTGGGG - Intronic
1116764296 14:49051597-49051619 ACAGCCACTGTGTGTTTTAGAGG - Intergenic
1118103562 14:62632314-62632336 AGAGCCACTGTGTCTATTAGTGG - Intergenic
1119191346 14:72684328-72684350 TGAGCCACAGCCTGCTTTAGAGG + Intronic
1119731982 14:76956825-76956847 AGAGCCTCTGCCTCATTTCCGGG - Intergenic
1121535083 14:94685637-94685659 AGAGCCCGTGCTGCTTTTAGAGG + Intergenic
1124369523 15:29095986-29096008 AGAGTCGCTGCCGCCTTTAGAGG + Intronic
1124397479 15:29316511-29316533 AGGGCCACCTTCTCTTTTAGAGG + Intronic
1127133538 15:55894998-55895020 TGAGCCCCTCCCTTTTTTAGAGG - Intronic
1128504258 15:68255377-68255399 AGAACCACTGCTTTTTTGAGGGG - Intronic
1129792398 15:78350065-78350087 AGAGCCACTGGCACTTTCATGGG - Intergenic
1131706167 15:94998913-94998935 AAAGGCCCTGCCTCTTTTAAGGG - Intergenic
1134183387 16:12064890-12064912 GGAGCCACTTCGTCTTTTAATGG + Intronic
1140454114 16:75094819-75094841 AGATCCACTGCCTGGTCTAGTGG - Intronic
1142288032 16:89179414-89179436 AGAGCCTCTGCCTGTCTTTGGGG + Exonic
1143615870 17:8048789-8048811 AGAACCACTGAGTCTTTTGGAGG + Exonic
1144274113 17:13648553-13648575 GAAGCCACTGCCTCCCTTAGAGG + Intergenic
1144471644 17:15547929-15547951 AGAACCACTGAATCTATTAGTGG - Intronic
1144924834 17:18796777-18796799 AGAACCACTGAATCTATTAGTGG + Intronic
1150180399 17:63113333-63113355 AGAGTAACTCCCTCTCTTAGAGG + Intronic
1150205937 17:63407413-63407435 AGAGTTCCTGCCTCTTTCAGTGG - Intronic
1151723773 17:75873262-75873284 AGAGCCTCTGCCTCTCTTCTGGG - Intergenic
1152630826 17:81410053-81410075 AGGGCAACTGCCCATTTTAGAGG - Intronic
1153067636 18:1064193-1064215 AAAGGCATTGCCTCTTTTTGGGG + Intergenic
1154108415 18:11545442-11545464 AGAGCCTCTCCTTGTTTTAGGGG + Intergenic
1154493029 18:14935517-14935539 AGAGCCTCTGCCCCTGTCAGTGG - Intergenic
1156718382 18:40040208-40040230 TGGGCCACTGCCTCTTGTACAGG + Intergenic
1158168439 18:54569235-54569257 AGAACCATTCACTCTTTTAGAGG + Intergenic
1160779511 19:871688-871710 AGAGCCACTGCCACCTGCAGGGG + Intronic
1163290318 19:16375569-16375591 AGAGCCACTGCCTCTGTGTAAGG + Intronic
1166936296 19:46335160-46335182 AGAGCCCCTGCCTCCCTTAGGGG - Intronic
1167606762 19:50485419-50485441 GGAGGCACTGGCTCCTTTAGTGG - Exonic
925911650 2:8577707-8577729 AGAGCCACTGCCTGTCCTGGAGG + Intergenic
929210136 2:39346961-39346983 AGAACCACTCACTCTTTTAGAGG - Intronic
929844998 2:45515621-45515643 AGAGTCACTGCCTCCTTAGGAGG - Intronic
930462036 2:51693723-51693745 AAAGCCACTGTTTCTTATAGTGG + Intergenic
934547576 2:95231373-95231395 AGAGTCACTGCTACTTTGAGGGG + Intronic
938982133 2:136537061-136537083 AAGGCCACTGCCACTTTAAGGGG + Intergenic
941164203 2:162067719-162067741 AGAGACACACCCTCTTTTGGAGG + Intronic
943029659 2:182670801-182670823 AGAGTCACTATTTCTTTTAGAGG + Intergenic
946035480 2:216738843-216738865 AGAGGCAGTGACTCCTTTAGGGG - Intergenic
947693044 2:232157609-232157631 AGAGTAAGTGTCTCTTTTAGTGG + Intronic
948904172 2:240970355-240970377 AGAGTCTCTGCCTCTTCTGGGGG + Intronic
1169072030 20:2738632-2738654 GGAGCCACTGCCACTCTTGGTGG + Intronic
1171975745 20:31593700-31593722 AGGGCCACTGCTTCTGTGAGGGG + Intergenic
1172600029 20:36177181-36177203 AGAGTCCCTGCCTCTTTGGGTGG + Intronic
1174839227 20:53885957-53885979 AGAGTCACTACTGCTTTTAGAGG + Intergenic
1178421312 21:32445685-32445707 AGAGCTCCTGCCACTCTTAGGGG + Intronic
1179971785 21:44840093-44840115 GGAGGCACTGTCTTTTTTAGGGG - Intergenic
1181018553 22:20085768-20085790 AGAACCACTGCCTCAATTATTGG - Exonic
1183148656 22:36019126-36019148 AGATTCACTGGCTGTTTTAGTGG - Intronic
1183864487 22:40693344-40693366 GGCGCAACTGCCTCTTTTAGGGG + Intergenic
1184624422 22:45712575-45712597 ACACCCACTGCCTCCCTTAGAGG + Intronic
949933333 3:9097760-9097782 AAGCCCACAGCCTCTTTTAGAGG + Intronic
960658253 3:120029840-120029862 AGAGCCACCTCCTTTTTTGGGGG - Intronic
963093022 3:141504407-141504429 AGAGACACAGCCTCTTGTTGGGG - Intronic
964579907 3:158222028-158222050 AAAGCCATTGCCATTTTTAGGGG + Intronic
966020811 3:175206784-175206806 AGAGCCACTGACACTTTTTCTGG + Intronic
966449411 3:180040997-180041019 AGAGCAACATCCTCTTCTAGTGG + Intergenic
970139337 4:12964267-12964289 AGAGTCAAGGCCTCTTTCAGCGG - Intergenic
970445954 4:16123533-16123555 AGAGCACCTGCCTCTCTGAGGGG + Intergenic
970695927 4:18676945-18676967 AGAGCCACTACCTCTTGCTGGGG - Intergenic
971040039 4:22741813-22741835 CGAGCCACGCCCTCTTCTAGGGG + Intergenic
973871308 4:55169571-55169593 AGACACACTGCCTCCTTAAGCGG - Intergenic
974632821 4:64517099-64517121 ATCGCCACTGCCTCTTTAAAAGG - Intergenic
976348853 4:84037181-84037203 AGTGCCACTGTTACTTTTAGTGG + Intergenic
986624374 5:9709625-9709647 ACAGCCACTGCCACATTTTGAGG + Intronic
988146524 5:27315969-27315991 AGATTCAGTGCCTGTTTTAGAGG + Intergenic
988671788 5:33389338-33389360 AGAGAGACTGCCTCTTCAAGTGG + Intergenic
991252468 5:64578800-64578822 AGAACCACTGCCTATTTCAGTGG - Intronic
993806209 5:92413050-92413072 AGAGCCACTGCCAATATTGGAGG + Intergenic
997522663 5:134533152-134533174 AGGGTCACTGCCTCTTTTTTAGG + Intronic
998000490 5:138621267-138621289 GGAGCCTCTGGCTCTTTTATAGG + Intronic
999259885 5:150231659-150231681 AGAGCCAGTGTCTCTGTTGGCGG + Intronic
1001293302 5:170481300-170481322 AGAGCCCCTGTTTCTTTAAGTGG + Intronic
1003858380 6:10298933-10298955 AGAGCTACGGCCTCTTTTCTGGG - Intergenic
1005990573 6:30899407-30899429 AGTCTCACTGCCTCTATTAGAGG - Exonic
1006127348 6:31847976-31847998 AGTTCCTCTGCCTCTTTTAGAGG - Intergenic
1007952890 6:45887701-45887723 AAAGCCATTGTCTGTTTTAGAGG - Intergenic
1010853756 6:80812029-80812051 AGTACCACTGCCTCTTTTTCTGG + Intergenic
1015836771 6:137428426-137428448 AGTGCAACTGCCCTTTTTAGGGG - Intergenic
1016361194 6:143268972-143268994 TGACCCACTTCCTCTATTAGGGG + Intronic
1017261619 6:152394387-152394409 AGATGCACTGGCTCTTTAAGAGG + Intronic
1018809932 6:167291708-167291730 AGAACCACTGTTTGTTTTAGAGG - Intronic
1019210093 6:170397875-170397897 AGAGCCACAGCCTCTCTTTCGGG + Intronic
1019795610 7:3045908-3045930 AATGCCACTGCCTGATTTAGAGG - Intergenic
1023498017 7:40818500-40818522 ACAGCCACTGCCCCTTTTTGAGG - Intronic
1032525999 7:132578346-132578368 AGAGCCATGGGCTCCTTTAGAGG - Intronic
1034215313 7:149401187-149401209 AAAGCCACTGCCGAATTTAGGGG - Intergenic
1034540020 7:151751920-151751942 AGAGCCCTTGTCACTTTTAGTGG - Intronic
1036717436 8:11139389-11139411 AGAGCCCATGCCTCCTCTAGTGG - Intronic
1037022288 8:13988465-13988487 AGAGCCTTTGCCTCTCTGAGTGG + Intergenic
1038373368 8:27013832-27013854 AGAGCAATTGCATATTTTAGGGG - Intergenic
1041309914 8:56505915-56505937 CAAGCTACTGTCTCTTTTAGAGG + Intergenic
1042293656 8:67196716-67196738 AAAGCCTCTGACTCTTCTAGGGG + Intronic
1044415912 8:91939346-91939368 AGAAACAATGCTTCTTTTAGAGG + Intergenic
1044445732 8:92273116-92273138 AGCGCCACTGCCACTTTCAAAGG + Intergenic
1046363504 8:113193371-113193393 ACTTTCACTGCCTCTTTTAGAGG + Intronic
1050336003 9:4590609-4590631 AATGCCATTGCCTCTTCTAGGGG + Intronic
1052197266 9:25732814-25732836 AGAGAGACTGCCTCCTTAAGTGG + Intergenic
1052820859 9:33137115-33137137 AGAGCCACTGGAGGTTTTAGTGG - Intronic
1052990673 9:34517819-34517841 TGAGCCACTGCCTCATTGACTGG + Intronic
1055276815 9:74626753-74626775 AGAGCCTATGCCTGTTATAGTGG + Intronic
1056780202 9:89543474-89543496 AGAGCTTCTGCCTCTGATAGTGG + Intergenic
1057251605 9:93507805-93507827 GGATCCACTGCCTCTTATTGAGG - Intronic
1060788305 9:126467853-126467875 ACAGCTCCTGTCTCTTTTAGAGG + Intronic
1060964415 9:127704738-127704760 AGATTAACTGCCTCTTTTATTGG + Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1191076630 X:56460653-56460675 AGAGAGACTGCCTCCTTGAGTGG - Intergenic
1195177663 X:102326633-102326655 AGAGCAACTGGCTCTTTGGGTGG - Exonic
1195181201 X:102360460-102360482 AGAGCAACTGGCTCTTTGGGTGG + Exonic
1195431269 X:104792107-104792129 AGAACTATTGCCTCTTTTAGAGG + Intronic
1196136866 X:112219831-112219853 AGAGCCTCTGCCCCTTATACTGG + Intergenic
1197375839 X:125681252-125681274 ATATCCACTTCCTCTTTTAAGGG - Intergenic
1198777874 X:140199932-140199954 AGAACCACAGACTCTCTTAGAGG - Intergenic
1199470084 X:148185556-148185578 AGTGCCACTTCCTCTCTTAGAGG + Intergenic
1201907540 Y:19100960-19100982 AGAGCCACTGGCCCTTTGACTGG - Intergenic