ID: 1089819643

View in Genome Browser
Species Human (GRCh38)
Location 11:121213112-121213134
Sequence GATCCCACCACCATTACTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089819640_1089819643 20 Left 1089819640 11:121213069-121213091 CCAGGAGGCAGCAGGATCTGGGA No data
Right 1089819643 11:121213112-121213134 GATCCCACCACCATTACTATGGG No data
1089819637_1089819643 25 Left 1089819637 11:121213064-121213086 CCAGGCCAGGAGGCAGCAGGATC No data
Right 1089819643 11:121213112-121213134 GATCCCACCACCATTACTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089819643 Original CRISPR GATCCCACCACCATTACTAT GGG Intergenic
No off target data available for this crispr