ID: 1089822684

View in Genome Browser
Species Human (GRCh38)
Location 11:121242044-121242066
Sequence CCGCTGCAGCCACCCAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089822684_1089822696 16 Left 1089822684 11:121242044-121242066 CCCTCTTTGGGTGGCTGCAGCGG No data
Right 1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG No data
1089822684_1089822691 9 Left 1089822684 11:121242044-121242066 CCCTCTTTGGGTGGCTGCAGCGG No data
Right 1089822691 11:121242076-121242098 AGCTCCTACTTTAACTCAGAAGG No data
1089822684_1089822692 10 Left 1089822684 11:121242044-121242066 CCCTCTTTGGGTGGCTGCAGCGG No data
Right 1089822692 11:121242077-121242099 GCTCCTACTTTAACTCAGAAGGG No data
1089822684_1089822695 15 Left 1089822684 11:121242044-121242066 CCCTCTTTGGGTGGCTGCAGCGG No data
Right 1089822695 11:121242082-121242104 TACTTTAACTCAGAAGGGGCAGG No data
1089822684_1089822693 11 Left 1089822684 11:121242044-121242066 CCCTCTTTGGGTGGCTGCAGCGG No data
Right 1089822693 11:121242078-121242100 CTCCTACTTTAACTCAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089822684 Original CRISPR CCGCTGCAGCCACCCAAAGA GGG (reversed) Intergenic
No off target data available for this crispr