ID: 1089822688

View in Genome Browser
Species Human (GRCh38)
Location 11:121242067-121242089
Sequence TTAAAGTAGGAGCTCCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089822688_1089822695 -8 Left 1089822688 11:121242067-121242089 CCCCTGAGGAGCTCCTACTTTAA No data
Right 1089822695 11:121242082-121242104 TACTTTAACTCAGAAGGGGCAGG No data
1089822688_1089822696 -7 Left 1089822688 11:121242067-121242089 CCCCTGAGGAGCTCCTACTTTAA No data
Right 1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089822688 Original CRISPR TTAAAGTAGGAGCTCCTCAG GGG (reversed) Intergenic
No off target data available for this crispr