ID: 1089822690

View in Genome Browser
Species Human (GRCh38)
Location 11:121242069-121242091
Sequence AGTTAAAGTAGGAGCTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089822690_1089822695 -10 Left 1089822690 11:121242069-121242091 CCTGAGGAGCTCCTACTTTAACT No data
Right 1089822695 11:121242082-121242104 TACTTTAACTCAGAAGGGGCAGG No data
1089822690_1089822696 -9 Left 1089822690 11:121242069-121242091 CCTGAGGAGCTCCTACTTTAACT No data
Right 1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089822690 Original CRISPR AGTTAAAGTAGGAGCTCCTC AGG (reversed) Intergenic
No off target data available for this crispr