ID: 1089822696

View in Genome Browser
Species Human (GRCh38)
Location 11:121242083-121242105
Sequence ACTTTAACTCAGAAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089822688_1089822696 -7 Left 1089822688 11:121242067-121242089 CCCCTGAGGAGCTCCTACTTTAA No data
Right 1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG No data
1089822683_1089822696 17 Left 1089822683 11:121242043-121242065 CCCCTCTTTGGGTGGCTGCAGCG No data
Right 1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG No data
1089822684_1089822696 16 Left 1089822684 11:121242044-121242066 CCCTCTTTGGGTGGCTGCAGCGG No data
Right 1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG No data
1089822689_1089822696 -8 Left 1089822689 11:121242068-121242090 CCCTGAGGAGCTCCTACTTTAAC No data
Right 1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG No data
1089822686_1089822696 15 Left 1089822686 11:121242045-121242067 CCTCTTTGGGTGGCTGCAGCGGC No data
Right 1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG No data
1089822679_1089822696 30 Left 1089822679 11:121242030-121242052 CCAGGGTCTGCAGCCCCTCTTTG No data
Right 1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG No data
1089822690_1089822696 -9 Left 1089822690 11:121242069-121242091 CCTGAGGAGCTCCTACTTTAACT No data
Right 1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089822696 Original CRISPR ACTTTAACTCAGAAGGGGCA GGG Intergenic
No off target data available for this crispr