ID: 1089833886

View in Genome Browser
Species Human (GRCh38)
Location 11:121353069-121353091
Sequence AAGCATATTTATCAGTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089833885_1089833886 1 Left 1089833885 11:121353045-121353067 CCTTCAATCTTGCATGTACTCAT No data
Right 1089833886 11:121353069-121353091 AAGCATATTTATCAGTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089833886 Original CRISPR AAGCATATTTATCAGTACCC TGG Intergenic
No off target data available for this crispr