ID: 1089834174

View in Genome Browser
Species Human (GRCh38)
Location 11:121355663-121355685
Sequence CCATAAAAACACAAAGAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089834170_1089834174 7 Left 1089834170 11:121355633-121355655 CCAATGATTTACTCAATCATAAT No data
Right 1089834174 11:121355663-121355685 CCATAAAAACACAAAGAATGGGG No data
1089834169_1089834174 14 Left 1089834169 11:121355626-121355648 CCAATGGCCAATGATTTACTCAA No data
Right 1089834174 11:121355663-121355685 CCATAAAAACACAAAGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089834174 Original CRISPR CCATAAAAACACAAAGAATG GGG Intergenic
No off target data available for this crispr