ID: 1089834441

View in Genome Browser
Species Human (GRCh38)
Location 11:121357637-121357659
Sequence CAGGTGGTCGGGAGGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089834431_1089834441 7 Left 1089834431 11:121357607-121357629 CCAGGGAACCTGAGAAGGAAGGA No data
Right 1089834441 11:121357637-121357659 CAGGTGGTCGGGAGGGCAGGTGG No data
1089834432_1089834441 -1 Left 1089834432 11:121357615-121357637 CCTGAGAAGGAAGGAGATGAACC No data
Right 1089834441 11:121357637-121357659 CAGGTGGTCGGGAGGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089834441 Original CRISPR CAGGTGGTCGGGAGGGCAGG TGG Intergenic
No off target data available for this crispr