ID: 1089841362

View in Genome Browser
Species Human (GRCh38)
Location 11:121420911-121420933
Sequence CCAAAGGCAATATGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089841357_1089841362 14 Left 1089841357 11:121420874-121420896 CCTATCAAATGCAGGATTAAGTT No data
Right 1089841362 11:121420911-121420933 CCAAAGGCAATATGGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089841362 Original CRISPR CCAAAGGCAATATGGAAAAA TGG Intergenic
No off target data available for this crispr