ID: 1089845902

View in Genome Browser
Species Human (GRCh38)
Location 11:121458060-121458082
Sequence TGTCCCTCCATTACAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089845902_1089845909 3 Left 1089845902 11:121458060-121458082 CCACCCACTGTAATGGAGGGACA 0: 1
1: 0
2: 0
3: 13
4: 98
Right 1089845909 11:121458086-121458108 GGGGCAGTCTTATCATAATCTGG 0: 1
1: 0
2: 0
3: 6
4: 53
1089845902_1089845910 11 Left 1089845902 11:121458060-121458082 CCACCCACTGTAATGGAGGGACA 0: 1
1: 0
2: 0
3: 13
4: 98
Right 1089845910 11:121458094-121458116 CTTATCATAATCTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089845902 Original CRISPR TGTCCCTCCATTACAGTGGG TGG (reversed) Intronic
902575935 1:17377593-17377615 AGTCCCTCCATCACAGTAGGCGG + Intronic
902755381 1:18545947-18545969 TGTCCCTCCTTTCCAGTTGAGGG + Intergenic
913092820 1:115491404-115491426 TGTCCCGCCATTGCACTGGCTGG + Intergenic
919429754 1:197477850-197477872 AGTCTCTCCATTGCAGGGGGTGG - Exonic
922710695 1:227828757-227828779 TGTCCCTACATAACCCTGGGGGG - Intronic
924546243 1:245030510-245030532 TGTCCTTCCAGTACACTGAGAGG - Intronic
1067900619 10:50237247-50237269 TGTCCTTGCATCACAGTGGATGG - Intronic
1069739574 10:70678955-70678977 AGGCCCTCCATAACAGTGGGTGG - Intronic
1070587611 10:77778734-77778756 TGGTCCTCCAGTACGGTGGGTGG - Intergenic
1071982900 10:91021824-91021846 TGTCCCTCTGTCACAGAGGGAGG - Intergenic
1072613095 10:97031892-97031914 TGTCCCTATTTTACAGTCGGGGG - Intronic
1073824072 10:107300221-107300243 TGTCCTTCCATATCACTGGGAGG + Intergenic
1076584843 10:131539653-131539675 TGTACCTCCACTGCTGTGGGAGG - Intergenic
1077429695 11:2510011-2510033 TGTCAATCCAGTACACTGGGAGG + Intronic
1078554112 11:12304707-12304729 TGTCACTGTAATACAGTGGGAGG - Intronic
1079738258 11:24024930-24024952 AGTCCCTCCTTTACAGTTGTGGG - Intergenic
1079953545 11:26834177-26834199 TTGCCCTCCATTAAAGTGGATGG - Intergenic
1083374644 11:62209571-62209593 TTCCTCTCCCTTACAGTGGGAGG + Intronic
1085734962 11:79031051-79031073 GGTCCCTACAATGCAGTGGGAGG - Intronic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1091610436 12:2003477-2003499 TGTCTCTACATTCGAGTGGGTGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1092595840 12:10003965-10003987 TTTCCCTCAATCACACTGGGTGG - Intronic
1093234801 12:16594643-16594665 TTTCCCTTCATTACACTGTGGGG - Intronic
1097920080 12:65062542-65062564 GGTCCCTCCATTAAAGCAGGTGG + Exonic
1098405661 12:70123488-70123510 TGTCCTTCCATTCAAGTCGGTGG - Intergenic
1109547152 13:63844272-63844294 AGGACCTCCATCACAGTGGGGGG + Intergenic
1110848604 13:80218454-80218476 TGGCCCTCCACTGCAGAGGGAGG - Intergenic
1110943695 13:81386150-81386172 TGTCCATCCATTACTTTTGGGGG + Intergenic
1112356210 13:98676599-98676621 TGTCCCTGCTTTGCAGTGGCTGG - Intergenic
1114668824 14:24398437-24398459 TGTCCCTAGACTTCAGTGGGGGG + Intergenic
1145975975 17:28984679-28984701 TTACCCTCTATGACAGTGGGTGG - Intronic
1151144899 17:72031436-72031458 TGCACATCCATTACAGTGAGGGG + Intergenic
1153591828 18:6682652-6682674 TCTCCCTCCATTACAGGGAAAGG - Intergenic
1156696910 18:39778561-39778583 TGTGCCTCCCTTACTATGGGAGG - Intergenic
1160113366 18:76054740-76054762 TGTCCCACCTTGACAGGGGGTGG - Intergenic
1161900238 19:7113092-7113114 TTTCTCTCCTTCACAGTGGGTGG - Intronic
1162873008 19:13600030-13600052 TCTCCCTCCAGCACAGTGAGGGG + Intronic
1164636098 19:29792499-29792521 TGTGCCTCCATTCCAGGAGGAGG + Intergenic
1165824353 19:38697285-38697307 TTTCCCTGCATACCAGTGGGTGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
926556911 2:14368577-14368599 TCTCCCTCCTTGAAAGTGGGTGG + Intergenic
929694549 2:44103013-44103035 TGTCCCTGTGATACAGTGGGGGG + Intergenic
929719620 2:44354382-44354404 TGTCTCCCCATTATATTGGGAGG - Intronic
932076111 2:68664406-68664428 TGTGCTTCCATCACAGTGAGGGG + Intergenic
932317525 2:70795858-70795880 TTTCCCTCCATGCCTGTGGGCGG + Intergenic
933554057 2:83809907-83809929 TGTACTTCCAGTACTGTGGGAGG + Intergenic
934522947 2:95031321-95031343 TGTCCCTTCATTCCTGTTGGGGG - Intronic
936256801 2:110923035-110923057 TCTCCCTACATCACAGTAGGGGG + Intronic
937190076 2:120086709-120086731 TCTCCCTCCATTACACAGGGTGG - Intronic
938176463 2:129135805-129135827 TATCTCTCCATTGGAGTGGGAGG + Intergenic
938214464 2:129499179-129499201 TAGCCCTCCAGTACAGTGTGAGG - Intergenic
942392605 2:175511311-175511333 TGTCACTGCACTACAGTGGCAGG + Intergenic
1169563255 20:6825054-6825076 TAACCCTCGATTACTGTGGGAGG + Intergenic
1173135670 20:40436750-40436772 GGTCCCTTCCTTACACTGGGCGG + Intergenic
1175749039 20:61482511-61482533 TGGCCCTCTTTTACTGTGGGTGG + Intronic
1177393433 21:20504909-20504931 TGTCCCACAATAATAGTGGGGGG - Intergenic
1184790163 22:46695275-46695297 TGTCCCTTCATAGCAGTGGTGGG + Exonic
949418258 3:3836781-3836803 TCTCCCTAGACTACAGTGGGTGG + Intronic
949505901 3:4727237-4727259 TGTCTCTCAATCACAGTGTGTGG - Intronic
949952472 3:9240631-9240653 TGTCTCTCCATGACGGTGGAAGG - Intronic
949995203 3:9611175-9611197 TGTCCTTTCTTTACACTGGGAGG - Intergenic
950189741 3:10968409-10968431 TGTCTCTCCATTAAAGTAAGTGG - Intergenic
952850580 3:37725172-37725194 TGTGGCTTCATTCCAGTGGGAGG + Intronic
960005936 3:112781197-112781219 TGTCCCTTCAGTCCTGTGGGTGG + Intronic
963361761 3:144282644-144282666 TGCCCCTCCCTTAAAGGGGGAGG - Intergenic
963961908 3:151318880-151318902 TGTCCCTTCACTACAGTAGGTGG + Intronic
967201987 3:187079831-187079853 TGGCCCTCCATTTCCTTGGGAGG - Intergenic
971060971 4:22969182-22969204 TGAACATGCATTACAGTGGGTGG - Intergenic
977883327 4:102231723-102231745 TGTTCCTCCCTTACTGTGGGAGG - Intergenic
982090479 4:151876039-151876061 TGTCCCATCATCTCAGTGGGGGG - Intergenic
984539770 4:181022920-181022942 TGTCCCTCGGTATCAGTGGGAGG - Intergenic
985651330 5:1109107-1109129 AGTCCCTCCTAGACAGTGGGTGG + Intronic
987073806 5:14361746-14361768 TGTCACTCCACTGAAGTGGGTGG + Intronic
990097523 5:52135519-52135541 TTTCTCTCCATTCCAGAGGGTGG + Intergenic
996708172 5:126518122-126518144 TGTGCCTGAATTCCAGTGGGAGG - Intergenic
997443728 5:133926546-133926568 TGTGCCTCCGTTACAGTCTGTGG + Intergenic
998589323 5:143460812-143460834 TTTCTCACTATTACAGTGGGAGG - Intergenic
1002205273 5:177558664-177558686 TGTACCTCCAACACTGTGGGAGG + Intergenic
1003616560 6:7659997-7660019 TGTCCCTCTCTAACAGTGAGTGG + Intergenic
1005737693 6:28764169-28764191 TCTCCCTCCGTTGAAGTGGGAGG - Intergenic
1007498090 6:42275521-42275543 TGTCCCTACATCACAGTGACTGG - Intronic
1012257890 6:97055333-97055355 TATCCCTCTTTTACAGTGGGAGG + Intronic
1012485009 6:99711393-99711415 TGTACAGCCATTAGAGTGGGTGG + Intergenic
1012526912 6:100188852-100188874 TGGCCCTCCATCACATTGGACGG + Intergenic
1013414340 6:109911610-109911632 TGTCTCTCAATTACTGTGGAAGG + Intergenic
1014242707 6:119035317-119035339 TGTCCCTGAATTCCAGTGGGAGG - Intronic
1016075316 6:139788714-139788736 GGTGCCTCCATGTCAGTGGGAGG + Intergenic
1018275489 6:162125856-162125878 TGTGACTCCGTTACAGTTGGAGG + Intronic
1018479252 6:164173636-164173658 TGTCCTTCCATGAAAGTGGACGG - Intergenic
1019263192 7:93879-93901 TGTTCCTCCAGGAAAGTGGGAGG - Intergenic
1019603275 7:1895870-1895892 TGTCCCTTCTTTCCAGTGGCAGG - Intronic
1019655913 7:2195560-2195582 TGCCCCTCCCTTGCTGTGGGAGG + Intronic
1019729478 7:2622430-2622452 TGTGGCTCCATTCCAGGGGGAGG - Intergenic
1020605011 7:10326413-10326435 TGTCCCTCCATTATAGAGGAGGG + Intergenic
1021423854 7:20476278-20476300 TGTCCCTCCCTAACGGTGTGGGG + Intergenic
1023026816 7:36058321-36058343 TGTCCCTCCCTCACTGTGGGAGG + Intergenic
1024305483 7:47925639-47925661 TGTGCCTCAATTCCAATGGGAGG - Intronic
1028489872 7:91399337-91399359 GGGCCCTACATTATAGTGGGAGG - Intergenic
1028602018 7:92611958-92611980 TGTCCCTCCTTTGAAGTGGATGG - Exonic
1030621572 7:111796156-111796178 TGTCCCTCTATCACAGGAGGCGG + Intronic
1032420639 7:131776281-131776303 GGTCCCACCATTGCAGTAGGAGG + Intergenic
1035026079 7:155827183-155827205 TGACCCTCAATCACAGTGTGAGG + Intergenic
1035314723 7:157990769-157990791 CTTCCCTCCGATACAGTGGGAGG + Intronic
1037643662 8:20771157-20771179 TGGCCCTCCTTTGCAGTGGGTGG + Intergenic
1038460073 8:27708899-27708921 TTTCCCTCCCTTACAGTGTGTGG + Intergenic
1039398634 8:37248440-37248462 TGTCCCTCCTTGACTGAGGGAGG + Intergenic
1039422015 8:37451091-37451113 TGTCTCTGCATCACAGTGGGAGG - Intergenic
1048018946 8:130520582-130520604 TGTTCCACCATTTCAGTCGGTGG + Intergenic
1052789872 9:32865351-32865373 TTACCCTGCATCACAGTGGGTGG - Intergenic
1060254015 9:122010583-122010605 TGTCCCTCCATTGCAGAGGATGG - Intronic
1060460738 9:123852115-123852137 TGTCCCGCCATTACACTCTGGGG + Intronic