ID: 1089845909

View in Genome Browser
Species Human (GRCh38)
Location 11:121458086-121458108
Sequence GGGGCAGTCTTATCATAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089845898_1089845909 14 Left 1089845898 11:121458049-121458071 CCAGCTTTGTTCCACCCACTGTA 0: 1
1: 0
2: 0
3: 18
4: 261
Right 1089845909 11:121458086-121458108 GGGGCAGTCTTATCATAATCTGG 0: 1
1: 0
2: 0
3: 6
4: 53
1089845902_1089845909 3 Left 1089845902 11:121458060-121458082 CCACCCACTGTAATGGAGGGACA 0: 1
1: 0
2: 0
3: 13
4: 98
Right 1089845909 11:121458086-121458108 GGGGCAGTCTTATCATAATCTGG 0: 1
1: 0
2: 0
3: 6
4: 53
1089845904_1089845909 -1 Left 1089845904 11:121458064-121458086 CCACTGTAATGGAGGGACACAGG 0: 1
1: 0
2: 2
3: 12
4: 177
Right 1089845909 11:121458086-121458108 GGGGCAGTCTTATCATAATCTGG 0: 1
1: 0
2: 0
3: 6
4: 53
1089845903_1089845909 0 Left 1089845903 11:121458063-121458085 CCCACTGTAATGGAGGGACACAG 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1089845909 11:121458086-121458108 GGGGCAGTCTTATCATAATCTGG 0: 1
1: 0
2: 0
3: 6
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089845909 Original CRISPR GGGGCAGTCTTATCATAATC TGG Intronic
903001404 1:20268690-20268712 AGGGCTGTCTTATCATAATGAGG + Intergenic
907516854 1:54998295-54998317 GGGGCAGTGTGGTCATGATCAGG - Intergenic
909376455 1:74947653-74947675 GGAGCTGTCCTATCATAGTCTGG + Intergenic
916293254 1:163189092-163189114 GGGACTGTCTTGTGATAATCAGG + Intronic
918432303 1:184474695-184474717 GGGGCAATCCTAACAAAATCAGG - Intronic
1071356479 10:84801515-84801537 GGGGCAGCCTTATCTTCCTCTGG - Intergenic
1074537311 10:114337740-114337762 GGGTCAGACTTATCACAAACAGG + Intronic
1080093031 11:28372045-28372067 TAGGCATTCTTATCATATTCTGG + Intergenic
1086259751 11:84924707-84924729 AAGGCAGTCTTATCCTAAGCTGG + Intronic
1089845909 11:121458086-121458108 GGGGCAGTCTTATCATAATCTGG + Intronic
1092512386 12:9170724-9170746 GAAGCAGTCTGATCACAATCTGG - Intronic
1095597365 12:43974555-43974577 GGAGCAGTCTTCTCACTATCAGG - Intronic
1099281338 12:80651575-80651597 TGGGCAGTGTTATCCTTATCAGG - Intronic
1102387939 12:112526691-112526713 GGGGGACTATTATCATCATCAGG - Intergenic
1103124811 12:118412153-118412175 AGGGCAGTCATATCATCCTCAGG - Intronic
1114771291 14:25430661-25430683 GGGGCAGTCTTATAAGGTTCAGG + Intergenic
1114897624 14:27010956-27010978 GGGGAAGTCTTAGTTTAATCAGG + Intergenic
1120718825 14:87868751-87868773 GGCTAAGTCTAATCATAATCTGG - Intronic
1124345206 15:28917648-28917670 GGGGCAGTATTATTATTAACTGG + Intronic
1125351534 15:38772384-38772406 GGGTCAGTCTTGTCATGCTCTGG - Intergenic
1125493048 15:40162742-40162764 GGGGCAGTCTTAGCTCAATTTGG + Intronic
1143052752 17:4140107-4140129 GTGGCAGTGTTGTCATCATCAGG - Intronic
1143247714 17:5500317-5500339 GGGGCATTCTAATTATAAACGGG + Intronic
1155074627 18:22343731-22343753 GGGAAAGTCTTATCATTATGGGG - Intergenic
1163463799 19:17454983-17455005 GGGGCAGGCTTTTCATAGACCGG + Intronic
925877333 2:8323899-8323921 GGCACAGACTTATCATAAGCGGG - Intergenic
928028784 2:27761354-27761376 GGTGCAGTCTTATCAGATTGGGG + Intergenic
929360133 2:41077989-41078011 GGAGCAGTCTTAGGATAATCTGG + Intergenic
929489903 2:42386713-42386735 GGGGCAGTGTGATCAGAATCAGG - Intronic
929714788 2:44298868-44298890 GGGGCAGTCATACAATAATTGGG + Intronic
931645923 2:64421890-64421912 TGGGCAGGCTTGACATAATCAGG - Intergenic
932171071 2:69556847-69556869 GGGGCAGCCTTACCATTATCTGG + Exonic
941699740 2:168591959-168591981 GAGGCATTCTTTTCATAATTGGG + Intronic
944300808 2:198123017-198123039 GGGGCAGTCTTGTCAGACTGTGG - Intronic
948957763 2:241307091-241307113 GGGGCAGTGTCATCCTAACCTGG + Intronic
1169332774 20:4729849-4729871 GGGGCAGTCTTTGGATGATCTGG - Intergenic
1174405243 20:50298713-50298735 GGGGCTGTTTTTTCTTAATCCGG - Intergenic
1174710989 20:52705365-52705387 GAGGCTGTCTTATCAAAATCAGG - Intergenic
1176738522 21:10575240-10575262 GAGGCAGTCTGGTCATGATCTGG - Intronic
951088164 3:18539236-18539258 GGGTCAGTCTTACGATAATATGG + Intergenic
967051769 3:185791568-185791590 GGGGCTCTCTTATCTTTATCTGG - Intronic
969450977 4:7273226-7273248 CTGGCAGTCTTATCCCAATCAGG + Intronic
969473178 4:7401784-7401806 GGGGCAGTCTCAGGATAATTGGG + Intronic
974258590 4:59494948-59494970 GAGGTAGTGTTATCTTAATCTGG - Intergenic
974345357 4:60673309-60673331 GGGTCTGTTTTATCATCATCTGG + Intergenic
977044807 4:92055864-92055886 TGGGCATTCTTATCACATTCCGG - Intergenic
981586904 4:146313226-146313248 GGGGCAGTCTTGTCCTAGCCAGG - Intronic
992655744 5:78907966-78907988 GGGGAAGTCTTGTGGTAATCAGG + Intronic
997842392 5:137253877-137253899 GGGGCAGCCTCAACATAAGCTGG - Intronic
998297597 5:140986490-140986512 GGGGCAGTCCTTTTATAACCTGG - Intronic
1008393533 6:50980581-50980603 TGGGCAACCTTATCATGATCAGG - Intergenic
1016417335 6:143846778-143846800 TGGGCATTCTTAACATAAACAGG - Intronic
1017734356 6:157347687-157347709 GAGGCAGTCTTGTCTTAACCTGG - Intergenic
1018016220 6:159714655-159714677 AGGGTAGGCTTATCATAATCTGG - Intronic
1020973796 7:14981123-14981145 GGCTCAGTCTTACCATAATATGG - Intergenic
1027980900 7:85220473-85220495 GGGTCAGTCATATGATTATCGGG + Intergenic
1032516213 7:132508225-132508247 GGGGGAGCCTTATCATAAGAAGG - Exonic
1034761719 7:153678964-153678986 GGGGGAGGCTCTTCATAATCAGG - Intergenic
1047549190 8:125851135-125851157 AGGGCAGGCTCATGATAATCTGG + Intergenic
1062743831 9:138198286-138198308 TGGGCACTCTTATCAGGATCAGG - Intergenic