ID: 1089846340

View in Genome Browser
Species Human (GRCh38)
Location 11:121461444-121461466
Sequence CAGTAATAGGAGATGCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089846340_1089846344 -2 Left 1089846340 11:121461444-121461466 CCAGAGGGCATCTCCTATTACTG 0: 1
1: 0
2: 2
3: 7
4: 101
Right 1089846344 11:121461465-121461487 TGAGAAATTGGCCAAGCCATGGG 0: 1
1: 0
2: 1
3: 80
4: 1872
1089846340_1089846343 -3 Left 1089846340 11:121461444-121461466 CCAGAGGGCATCTCCTATTACTG 0: 1
1: 0
2: 2
3: 7
4: 101
Right 1089846343 11:121461464-121461486 CTGAGAAATTGGCCAAGCCATGG 0: 1
1: 0
2: 4
3: 25
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089846340 Original CRISPR CAGTAATAGGAGATGCCCTC TGG (reversed) Intronic
900480212 1:2894546-2894568 CACTCAGAGGAGACGCCCTCCGG - Intergenic
901404713 1:9038435-9038457 ACGTCATAGGACATGCCCTCGGG - Exonic
905285847 1:36879825-36879847 CAGAAAGAGGAGATGGGCTCTGG - Intronic
905832019 1:41077235-41077257 CAAAATTAGCAGATGCCCTCAGG - Intronic
907538862 1:55193539-55193561 CAGTCACTGGAGATGCCCTAAGG - Intronic
909332828 1:74435065-74435087 CAGTATTAGGAGATTGCCACTGG - Intronic
919127914 1:193418493-193418515 CATTAACAGGAGAAGACCTCGGG + Intergenic
920674709 1:208030916-208030938 CAGCAGTGGGAGAAGCCCTCAGG - Intronic
924624442 1:245687631-245687653 CAGTAATAGGAGAGGCTGTCCGG - Exonic
1064221240 10:13442028-13442050 TAGAGATAGGAGAGGCCCTCTGG - Intronic
1065862782 10:29885777-29885799 GAGAAGAAGGAGATGCCCTCTGG - Intergenic
1068908729 10:62356039-62356061 TAGTACTAAGAGATGCCCTAAGG + Intergenic
1073077366 10:100832633-100832655 GAGGACTAGGGGATGCCCTCAGG - Intergenic
1074876126 10:117614687-117614709 GAGTAATAGGAGATGAGATCAGG + Intergenic
1075617751 10:123903870-123903892 CAGAAATAGGAGATGTGCTGGGG + Intronic
1084961190 11:72717521-72717543 CAGTGATGGGAGATGCACTGTGG - Intronic
1085869259 11:80330093-80330115 CAGTAATGGGAGCTGCCCTCTGG - Intergenic
1086243014 11:84719470-84719492 CAGTAACAGGACATGCACTCAGG + Intronic
1089846340 11:121461444-121461466 CAGTAATAGGAGATGCCCTCTGG - Intronic
1090325905 11:125886513-125886535 AAGCAAGAGGAGAGGCCCTCAGG - Intronic
1092272627 12:7035479-7035501 CAATACTAAGAGATGCTCTCAGG - Intronic
1092652783 12:10652757-10652779 AGGTAATATGAGATGCACTCTGG + Intronic
1094691934 12:32778000-32778022 CAGGAAGAGGACATGCCCTTGGG + Intergenic
1096023414 12:48340870-48340892 CAGTATTAGGAGATGCCCCAGGG - Exonic
1096076640 12:48810098-48810120 CAGAATTAGGACTTGCCCTCTGG + Intergenic
1096313149 12:50539726-50539748 AAGTAATAGAAGAGGCCCACGGG - Intronic
1097819032 12:64108735-64108757 GGGTCAGAGGAGATGCCCTCTGG + Intronic
1101546732 12:105720408-105720430 GAGTAATAGAACATGCCCTTTGG - Intergenic
1101563202 12:105879905-105879927 TAGTAATAGGGGATGACGTCAGG + Intergenic
1103396781 12:120613236-120613258 GAATACTAAGAGATGCCCTCTGG - Intergenic
1105767683 13:23578090-23578112 AGGAATTAGGAGATGCCCTCGGG + Intronic
1105829223 13:24149564-24149586 CAGGAATCAGAGATGCCCTGAGG + Intronic
1106573702 13:30954960-30954982 GAATAATAGGAGCTGCCATCTGG - Intronic
1110582721 13:77150517-77150539 CTGTAATTGGTGATCCCCTCTGG + Intronic
1113464025 13:110501534-110501556 CAGTGATGGGAGGTGCCCTCAGG - Intronic
1115057532 14:29148528-29148550 CAGAAATAGGAGACACCATCAGG - Intergenic
1115950652 14:38717641-38717663 CAATAATAGTAGATTCTCTCTGG - Intergenic
1117941362 14:60969629-60969651 CAGGAATAGGATATGCAGTCTGG - Exonic
1118771543 14:68945945-68945967 CTGTAAAATGAGATGCCTTCTGG - Intronic
1119479553 14:74951043-74951065 CAGTCCTAGCAGAGGCCCTCGGG + Intronic
1125520734 15:40346582-40346604 CAGTAATAGGAGGTGAACGCTGG + Intergenic
1126500923 15:49343631-49343653 GAGTAAAATGAGTTGCCCTCAGG - Intronic
1127733578 15:61821350-61821372 CAGAAATAGGAGAAGGCATCAGG - Intergenic
1136188110 16:28600038-28600060 CAGTGACAAGAGCTGCCCTCGGG + Intergenic
1136190582 16:28613032-28613054 CAGTGACAAGAGCTGCCCTCGGG + Intronic
1141821683 16:86450599-86450621 CAGGAATGAGAGCTGCCCTCAGG - Intergenic
1142174788 16:88640115-88640137 CATAAATAGGGGGTGCCCTCTGG - Exonic
1145090259 17:19980153-19980175 CAGGGATCCGAGATGCCCTCGGG + Intergenic
1148811005 17:50291211-50291233 CAGTTATAGGACAAGCCCTGGGG + Intergenic
1149647388 17:58250049-58250071 CAGGAATAGGAGAGGGGCTCTGG - Intronic
1155079241 18:22391430-22391452 CTTTAATGGGGGATGCCCTCCGG - Intergenic
1155439383 18:25845367-25845389 CATAAATAAGAGATGCACTCTGG + Intergenic
1156064295 18:33120418-33120440 GAGTAATAAGAGATGCCTACAGG - Intronic
1157687009 18:49650807-49650829 CAGTGAAAGGAGAAGACCTCAGG - Intergenic
1159293307 18:66450084-66450106 CAGTACTAAGAGATACCCTAAGG + Intergenic
1161208916 19:3056337-3056359 CAGTACTACGAGATGTCCTACGG - Exonic
925489656 2:4377396-4377418 GAGGAATAGGAGAATCCCTCTGG - Intergenic
927152424 2:20203711-20203733 GAGGAATACGAGATGCCCGCAGG + Intronic
929467005 2:42154112-42154134 CAATAGGAGGAGATGCCCTCTGG + Intergenic
929951853 2:46417299-46417321 CAGTCATAGGTCATGGCCTCTGG - Intergenic
932061104 2:68498719-68498741 CAGTGATTGGTTATGCCCTCAGG + Intronic
935568003 2:104629845-104629867 CAGGAGCAGGAGATTCCCTCGGG - Intergenic
937329964 2:121020340-121020362 TATTATTAGGAGATGCACTCTGG + Intergenic
941759663 2:169227927-169227949 CAGTAATAGGAGATGGACCCTGG + Intronic
942009347 2:171743482-171743504 CAGTCATAGCAGATGCTCACTGG - Intronic
946767745 2:223055739-223055761 CAGAAATAAGATACGCCCTCAGG - Intronic
1169660529 20:7973653-7973675 CAGGAACAGTAAATGCCCTCAGG + Intergenic
1171336020 20:24386191-24386213 CAGACATAGGAAAGGCCCTCCGG + Intergenic
1173051662 20:39568263-39568285 CAGAAATGTGAGATGCCTTCTGG + Intergenic
1174110462 20:48194648-48194670 AGGTAATGGGAGATGCCCCCAGG + Intergenic
1175326315 20:58130891-58130913 AAGAAATAGGAGCTGCCTTCAGG + Intergenic
1177095540 21:16827353-16827375 CTTTAATAGTAGATGCTCTCTGG - Intergenic
1178314296 21:31556376-31556398 CAGTGGTTGGAGAAGCCCTCAGG - Intronic
1180009698 21:45041105-45041127 AAGTAACAGGAGCTGCCCTGGGG - Intergenic
1185140520 22:49098396-49098418 CAGTATTAGGAGACACCCTGCGG - Intergenic
951089620 3:18557009-18557031 CAGTAATAGCATATTTCCTCTGG + Intergenic
955512518 3:59695572-59695594 CAGTAATAGCAAAGGCCCTCTGG - Intergenic
956856338 3:73278589-73278611 AAGTAACTGCAGATGCCCTCTGG + Intergenic
958878928 3:99647202-99647224 CAGTCCCAGGAGATGCGCTCAGG - Intronic
962317288 3:134366873-134366895 CAGTTTTAGCAGATGGCCTCAGG - Intronic
964866646 3:161269714-161269736 CAGAAATTGGAGATGCCCCTGGG + Intergenic
968148652 3:196320277-196320299 CAGGAATAGGATGTGCTCTCTGG + Intronic
969296443 4:6272996-6273018 GAGTCACTGGAGATGCCCTCGGG - Intronic
970667783 4:18357990-18358012 CAGGAACATGAGATTCCCTCTGG + Intergenic
974434591 4:61840510-61840532 TAATAAAAGGAGATGCTCTCAGG - Intronic
976110987 4:81673607-81673629 CAGTAAAAGGAGGTGGCCTTGGG - Intronic
978288994 4:107115392-107115414 CAGTGATAGGATAGGCCATCTGG + Intronic
981124747 4:141092980-141093002 TAGGAGTAGTAGATGCCCTCAGG - Intronic
986821334 5:11469969-11469991 GAGTCATAGGATATGCACTCCGG - Intronic
988492604 5:31717632-31717654 CAGTAATGAGAGATGCCATGTGG + Intronic
988781255 5:34524134-34524156 AAGTTATAGGAGATACCCTGGGG - Intergenic
990377496 5:55186271-55186293 CAGTGTTAGAAGAAGCCCTCTGG - Intergenic
990690493 5:58358641-58358663 GAGCAATAGAAGATGCCCTGGGG + Intergenic
992932016 5:81657637-81657659 CTGTAATAAGAGTTGCCCTTAGG - Intronic
1003369532 6:5510798-5510820 CTGTCAGAGGAGATGACCTCAGG + Intronic
1008495447 6:52128666-52128688 GAGTAATAGGGGATGAGCTCAGG + Intergenic
1014538621 6:122647973-122647995 TAGTAATAAGAGATGCCCTCAGG + Intronic
1022866753 7:34429682-34429704 CAGTATTAAGAGGTGGCCTCAGG + Intergenic
1023110024 7:36800735-36800757 CAGTTATAGAAGATGCACTATGG + Intergenic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1027951618 7:84823770-84823792 GAGTAATGAGAGATGCCATCAGG + Intergenic
1030192648 7:106824801-106824823 TAGTACTAAGAGATGCCCTAAGG - Intergenic
1030926520 7:115462341-115462363 TAGTAATAGCAGATGACCTAAGG - Intergenic
1045849785 8:106681114-106681136 CAGTAATATGAGATGCCACTTGG + Intronic
1048080591 8:131122352-131122374 CAGTAAAAGGAGGTGATCTCTGG - Intergenic
1056450224 9:86709604-86709626 CAGTCATAGGACATGCCCAGTGG - Intergenic
1057223374 9:93270027-93270049 CAGGAATGGGAGATGCTCCCTGG - Intronic
1060270906 9:122140778-122140800 CAGTAATAGTACCTGCCTTCTGG - Intergenic
1186083015 X:5953844-5953866 CAATGATAGGAGATGCCCCACGG + Intronic
1191013167 X:55782428-55782450 CATTAATAGGAGTTGCCTCCTGG - Intergenic
1191631497 X:63326657-63326679 TAGTACTAAGAGATGCCCTAAGG - Intergenic