ID: 1089851361

View in Genome Browser
Species Human (GRCh38)
Location 11:121499504-121499526
Sequence ATCTGCCTGTAGAAGGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089851361_1089851366 25 Left 1089851361 11:121499504-121499526 CCCTGAGCCTTCTACAGGCAGAT 0: 1
1: 0
2: 3
3: 16
4: 130
Right 1089851366 11:121499552-121499574 TGTCTAGGGAATATTTCTCAAGG 0: 1
1: 0
2: 0
3: 23
4: 173
1089851361_1089851365 11 Left 1089851361 11:121499504-121499526 CCCTGAGCCTTCTACAGGCAGAT 0: 1
1: 0
2: 3
3: 16
4: 130
Right 1089851365 11:121499538-121499560 CAGAGTTGTACTACTGTCTAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1089851361_1089851368 30 Left 1089851361 11:121499504-121499526 CCCTGAGCCTTCTACAGGCAGAT 0: 1
1: 0
2: 3
3: 16
4: 130
Right 1089851368 11:121499557-121499579 AGGGAATATTTCTCAAGGGATGG 0: 1
1: 0
2: 1
3: 20
4: 286
1089851361_1089851364 10 Left 1089851361 11:121499504-121499526 CCCTGAGCCTTCTACAGGCAGAT 0: 1
1: 0
2: 3
3: 16
4: 130
Right 1089851364 11:121499537-121499559 ACAGAGTTGTACTACTGTCTAGG 0: 1
1: 0
2: 0
3: 11
4: 88
1089851361_1089851367 26 Left 1089851361 11:121499504-121499526 CCCTGAGCCTTCTACAGGCAGAT 0: 1
1: 0
2: 3
3: 16
4: 130
Right 1089851367 11:121499553-121499575 GTCTAGGGAATATTTCTCAAGGG 0: 1
1: 0
2: 1
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089851361 Original CRISPR ATCTGCCTGTAGAAGGCTCA GGG (reversed) Intronic
901915062 1:12492731-12492753 ATCTTCCTGTTGATGGCACATGG - Intronic
902385952 1:16076067-16076089 ATCTGCCTGTGCCAGGCTCTGGG + Intergenic
903403673 1:23078250-23078272 GTCTGCCTGCAAAAGGCTCAAGG - Intronic
904576728 1:31509620-31509642 CTCTGCCTCCAGAAGGCTCATGG - Intergenic
908828865 1:68159565-68159587 GTCTGCCTGTAGAAGCCACGTGG + Intronic
916066126 1:161137144-161137166 AACAGCCTGTAGAAGGTTGAAGG + Intergenic
917644256 1:177014486-177014508 TTCTGCCTGTGGAATCCTCATGG + Intronic
921636008 1:217494436-217494458 ATTTGCATTTAGAAGGCTCCTGG + Intronic
924841733 1:247717747-247717769 ATATTTCTGTAGAAGGATCACGG - Intergenic
1067979275 10:51065443-51065465 ATTTGCCTGTTTAAGGCCCATGG - Intronic
1068349825 10:55828890-55828912 ATCTGACTTTAGTAGCCTCAGGG - Intergenic
1070065833 10:73033399-73033421 GTCTGCCTCTATAAGGCTGAAGG - Intronic
1070950318 10:80425849-80425871 AGCTTCCTGTAGAAGACACAAGG - Exonic
1071337569 10:84613457-84613479 CTCTGCCTGCAGGGGGCTCATGG - Intergenic
1072828081 10:98628710-98628732 CTCTGCCTCTAGCAGGCCCAAGG - Intronic
1073697261 10:105883759-105883781 AACTGGCTGTAGAAGGTACAAGG - Intergenic
1074396257 10:113100366-113100388 ATCTGCCTTTAGAAGGCAGAAGG + Intronic
1074458053 10:113612644-113612666 ATCTGGATGAAGAAGGCCCATGG + Intronic
1074798395 10:116972945-116972967 ATCTGCCTGGATGAGGCTCAAGG - Intronic
1075503295 10:122998016-122998038 ATTTACCTCTAGCAGGCTCAAGG + Intronic
1075733086 10:124647927-124647949 ATCAGCCAGCAGAGGGCTCAGGG + Intronic
1076524381 10:131102303-131102325 CTCTCCCTGGAGCAGGCTCAGGG - Intronic
1076842548 10:133052892-133052914 ATCTGCCTGTGCAAGGCCCTGGG - Intergenic
1079336950 11:19578332-19578354 ATTTGCTAGTAGAAGGCTCTTGG + Intronic
1080433815 11:32221716-32221738 CTCTGCCTGTGGGAGGGTCAGGG + Intergenic
1082810535 11:57476697-57476719 ATCTGCCTGCCGAAGACTCGCGG + Exonic
1085176098 11:74489422-74489444 ATTTCCCTGGAGAAGGCTCATGG + Intergenic
1087508141 11:99054736-99054758 ATCCCCAAGTAGAAGGCTCAAGG + Intronic
1087667376 11:101066164-101066186 ACCTGACTGGAGAAGGTTCAAGG - Intronic
1089851361 11:121499504-121499526 ATCTGCCTGTAGAAGGCTCAGGG - Intronic
1090642212 11:128739471-128739493 AAATGCCTTTTGAAGGCTCACGG - Intronic
1091193365 11:133712539-133712561 ATCTGCATGGAGAATGCTAATGG - Intergenic
1091356258 11:134940128-134940150 CTCTGCCTTTAGAAGGCTCAGGG + Intergenic
1092128171 12:6089853-6089875 ATCTGCCTGGAGAACACTGAAGG + Intronic
1101377451 12:104183518-104183540 ATCTGCCTGTGGCAGGGACATGG - Intergenic
1104724609 12:131068043-131068065 ATCTCCCTCCAGAAGGATCAGGG - Intronic
1105633667 13:22196951-22196973 TTCTACCAGTAGATGGCTCAGGG + Intergenic
1106944532 13:34811897-34811919 TTCTGCCTCTATAAAGCTCAAGG + Intergenic
1107345426 13:39455081-39455103 ATCTGCTTGTACATGGGTCATGG + Intronic
1111163197 13:84421638-84421660 ATATGCCTGTAAAAGCCACAGGG + Intergenic
1112450803 13:99507791-99507813 ATGTGACTGTACAAGGGTCATGG - Intronic
1118663380 14:68039634-68039656 ATTTTGCTGTAGAAGGCTGATGG - Intronic
1119949627 14:78730878-78730900 CTCCGCCTGCAGAAAGCTCAAGG - Intronic
1120265830 14:82249579-82249601 AGCTGCCTGTAGAAAGTACAAGG - Intergenic
1121262484 14:92576493-92576515 ATCTGCATGCAGAGGCCTCATGG + Intronic
1123899011 15:24857839-24857861 ATCTCCCTGTAGGGGGATCAGGG + Intronic
1124878665 15:33620832-33620854 ATCTGCCTGCTGAGGGCACAGGG + Intronic
1129251392 15:74311044-74311066 ATCTGCCTGGACAGGGCGCACGG + Intronic
1132889716 16:2197504-2197526 ATCTGCCTCTAGAATGCTGCAGG - Intergenic
1133124551 16:3637534-3637556 TCCTGCCTGTGGAAGGCTTAGGG + Intronic
1138344739 16:56312986-56313008 CCCTGCCTGTAGAAGGCTCTGGG - Intronic
1140035263 16:71366998-71367020 ATCTGAATGTACAAGGCTCAGGG + Intronic
1141446162 16:84060035-84060057 CGCTGCCCGTAGAAGGCTCATGG - Intronic
1141469060 16:84226181-84226203 GTCAGCCTGGAGAAGGCCCAGGG + Intronic
1141859460 16:86706593-86706615 ATCTGTGTGTAGCAGGCTCCAGG + Intergenic
1142106116 16:88303694-88303716 GCCTGCCTGTAAGAGGCTCATGG - Intergenic
1143303480 17:5928081-5928103 ATCTGCCTGTAGAAAGATTCTGG - Intronic
1147189671 17:38731130-38731152 ATCTCCCTGTCCAAAGCTCACGG + Intronic
1150145510 17:62765825-62765847 ATCTGGCTGTAGCAGGAGCAGGG + Intronic
1151396248 17:73825027-73825049 ATCTAACTGTAAAATGCTCAAGG - Intergenic
1154498374 18:14979169-14979191 CTCTGCCTCTAGAAGGCTCAGGG - Intergenic
1157733867 18:50029330-50029352 ATCTGAATGTGGAATGCTCAGGG + Intronic
1158432878 18:57406265-57406287 TTCTGCCTGAAGAACTCTCAAGG + Intergenic
1159307693 18:66666525-66666547 ATTTGCCTGTAGAAATCTGAGGG - Intergenic
1161659953 19:5539864-5539886 TTGGGCCTGGAGAAGGCTCAAGG + Intergenic
1164635208 19:29786509-29786531 ATGGGGCTGGAGAAGGCTCAGGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1166716133 19:44968951-44968973 CTCTGCCTGTAGAAGCCACAAGG - Intronic
1166830560 19:45637121-45637143 AGCTGCCTCGAGAAGGCTCTGGG + Intronic
924966806 2:84550-84572 AAGTGCCTGGAGCAGGCTCAGGG - Intergenic
925144818 2:1574231-1574253 ACCTGCCTGGAGAATGCTCTGGG - Intergenic
926321243 2:11749571-11749593 TTCTGCCTGTAGAAAGCTCTGGG + Intronic
928197247 2:29224802-29224824 ATCTGCCGGTAGAAGGGAGATGG - Intronic
934689096 2:96344317-96344339 ATGTGCCTGTTTAAGCCTCAAGG + Intronic
934856275 2:97732383-97732405 GTCTACCTGTTGAAGGCTCTGGG + Intronic
938964669 2:136377680-136377702 ATCTGCCTGTATGAGTCTCTCGG + Intergenic
939171685 2:138703435-138703457 CTCTGCCTTTAGAAGGCCCTGGG - Intronic
946209794 2:218138269-218138291 CTCTGCCTGGACAAGGCTGATGG + Intergenic
947170774 2:227309056-227309078 ACCTGCTTATATAAGGCTCAAGG - Exonic
948438445 2:237969371-237969393 AGCTCCCTGAAGGAGGCTCAGGG - Intronic
1170335832 20:15269221-15269243 ATCTGCATGAGGAAGGGTCATGG - Intronic
1173253100 20:41374989-41375011 AGCTGGCTGGAGAAGGCTCAGGG + Intergenic
1173897398 20:46561486-46561508 AGCTGCCTGGAGAAGGTTCTGGG - Intronic
1174278276 20:49419578-49419600 ATCTGCCTGCAGGAGGCACCTGG + Intronic
1175061541 20:56248169-56248191 ATCTCCCTGCAGAATCCTCAGGG + Intergenic
1175596391 20:60238089-60238111 ATCTGCCTGAAGAGGAATCAAGG - Intergenic
1177110646 21:17023679-17023701 AACTGCCTGTAGAGGGTTGAAGG - Intergenic
1179574736 21:42301080-42301102 ATGTGCCTGGAGGAGGCTCGAGG + Intergenic
1181094688 22:20496957-20496979 ATGTGGCTGGAGATGGCTCATGG + Intronic
1183043391 22:35200408-35200430 ATCTGTGTTTAGAGGGCTCAAGG - Intergenic
951369159 3:21823831-21823853 ATCTGCCTGTATAACTCCCAAGG + Intronic
953719998 3:45346922-45346944 ATCTGACTACAGAAGGCTCTGGG - Intergenic
957839685 3:85652263-85652285 CCCTGCTTCTAGAAGGCTCATGG - Intronic
959002828 3:100984666-100984688 ATCTTGCTGTGGAAGGCTCTTGG + Intronic
961906743 3:130270738-130270760 AGGTGCCTGTGGAAGGCACATGG + Intergenic
961934274 3:130566732-130566754 ATCTGCTTATCGATGGCTCAGGG + Exonic
964521521 3:157574322-157574344 ATCTGCATCTAGATGACTCAAGG - Intronic
969886061 4:10216627-10216649 ATGTGCCTGTAGAAGGGTCAGGG - Intergenic
971157850 4:24102592-24102614 ATCTTCTTTTAGAAGGCTTACGG + Intergenic
977772101 4:100871504-100871526 TTCTGCCAGTAGAAGTCTGAGGG - Intronic
978356879 4:107885162-107885184 ATCTCCCTTTAGAAGGCAAATGG + Intronic
980566008 4:134542268-134542290 TTCTACCTGGAGAATGCTCAAGG - Intergenic
986621696 5:9682412-9682434 TTCTGCCTGCAGAAAGCACAAGG - Intronic
988201388 5:28074515-28074537 TTCTGCCTGTAGTTGCCTCAGGG - Intergenic
989169639 5:38461735-38461757 ATTTGCTTGAACAAGGCTCATGG + Intronic
991560845 5:67950498-67950520 ATCTTCCTTTAAAAGGCACATGG - Intergenic
992783994 5:80153124-80153146 ATCTACCTGTAGAAGTCACATGG - Intronic
993733844 5:91452280-91452302 TTCTGCCTGTAGAAGGGTAGAGG + Intergenic
996439709 5:123476175-123476197 ATCTGAAAGTAGAAGGGTCAGGG - Intergenic
997068285 5:130589552-130589574 ATCTCCCTATACTAGGCTCAGGG - Intergenic
998151325 5:139759125-139759147 ATCTTCCTGAAGGAGGCCCATGG + Intergenic
998557420 5:143139103-143139125 ATCTGCCGGTAAAATGCTGAGGG + Intronic
998576088 5:143318209-143318231 ATGAGCCTGTAGAAGGTTAATGG + Intronic
998881704 5:146652025-146652047 GTGTGGCTGTAGAAGGGTCAGGG + Intronic
999069214 5:148725899-148725921 ATGTCCCTGTGGGAGGCTCAAGG + Intergenic
999859250 5:155627846-155627868 ATTTTCCTGTAGAAGGCACTTGG - Intergenic
1001691192 5:173633767-173633789 ACCTGCCTGAAGCAGGCTGATGG - Intergenic
1003077444 6:2995548-2995570 ATATGCCTGTATAAGACTAAGGG + Intronic
1009408996 6:63343804-63343826 AACTGCTTTTAAAAGGCTCATGG - Intergenic
1012432848 6:99184500-99184522 ATCTGCATGATGAAGGCTCAAGG + Intergenic
1014766398 6:125411389-125411411 ATGTGCATGTAGAAGGCCCCAGG - Intergenic
1016293725 6:142551643-142551665 AGCTGCCTTCTGAAGGCTCAGGG + Intergenic
1018437351 6:163774441-163774463 CTCTCCATGTAGAAGCCTCATGG - Intergenic
1019896829 7:3989482-3989504 CTCTGCCTGGGGGAGGCTCAGGG - Intronic
1024045471 7:45582677-45582699 ATCAGCCTGAAGAGGGCACAGGG - Intronic
1024287730 7:47773757-47773779 AGCTGCCTGTAAAAGGGGCATGG + Intronic
1028317253 7:89418986-89419008 ATCTGTCTGAAGAAGACTTAGGG - Intergenic
1029575545 7:101401140-101401162 ACCTGCCTGGAGAAGGCATAGGG + Intronic
1031660848 7:124422362-124422384 ATCTGGCTGCAGAAGCCCCAGGG + Intergenic
1032300877 7:130685673-130685695 ATATGTCCGTAGAAGGCTAAAGG + Intronic
1035525630 8:310980-311002 ATCTCCCTGCAGAGGGCTTATGG + Intergenic
1036221667 8:6926107-6926129 GTCTGCTGGGAGAAGGCTCAGGG + Intergenic
1039571521 8:38590465-38590487 CTCTGCCTGAAGCAGGCCCAAGG - Intergenic
1042188776 8:66164724-66164746 ATCTGCCTATAGTAGGCTATTGG - Intronic
1042781254 8:72493680-72493702 ATTTGACTGTAGAAGGCCCAAGG - Intergenic
1045657859 8:104405708-104405730 GTCTGCCTGGAGCAGGCACAAGG + Intronic
1049486839 8:142869595-142869617 ATCTGCCTGGCGGAGGCCCATGG - Intronic
1049730744 8:144176876-144176898 GTCTGCCTGCAGAAGCCTTAAGG + Intronic
1051593002 9:18795393-18795415 ATCTGGCTGTAGAAGAATCCTGG - Exonic
1051745115 9:20288226-20288248 ATCTGCCTGTAGGAACCTCAAGG + Intergenic
1060586340 9:124788635-124788657 ATCTTCCTATGGGAGGCTCAAGG - Intronic
1060776682 9:126379811-126379833 CTCTGCCTGTCACAGGCTCAGGG - Intronic
1061737906 9:132675318-132675340 ATCTGCCTGTAGAAAGCACCGGG + Intronic
1187100741 X:16188596-16188618 ATAAGCCTGTAAAAGGCTAAAGG - Intergenic
1190057077 X:47187247-47187269 ATCAGCCTGTTGAGGGCTCTGGG - Intergenic
1195137315 X:101922111-101922133 ATCTGCCACCAGGAGGCTCATGG + Intronic
1195314606 X:103665615-103665637 CTCTGCCTGCAGCAGGCACAGGG + Intergenic
1199712280 X:150477798-150477820 ACCTGCTTGCAGCAGGCTCAGGG + Intronic
1199772012 X:150981137-150981159 AACTGCTTGTAGAAGGAGCAGGG + Intronic
1200320848 X:155187509-155187531 ATCTACCTGTAGAAATATCAAGG - Intergenic