ID: 1089854410

View in Genome Browser
Species Human (GRCh38)
Location 11:121529937-121529959
Sequence TTTTATTTAGATTTTTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2169
Summary {0: 1, 1: 0, 2: 17, 3: 249, 4: 1902}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089854403_1089854410 27 Left 1089854403 11:121529887-121529909 CCTTCTGTCCTCTCTCCTTTTGT 0: 1
1: 0
2: 6
3: 122
4: 1176
Right 1089854410 11:121529937-121529959 TTTTATTTAGATTTTTTGGGGGG 0: 1
1: 0
2: 17
3: 249
4: 1902
1089854404_1089854410 19 Left 1089854404 11:121529895-121529917 CCTCTCTCCTTTTGTATTATCTA 0: 1
1: 0
2: 4
3: 42
4: 418
Right 1089854410 11:121529937-121529959 TTTTATTTAGATTTTTTGGGGGG 0: 1
1: 0
2: 17
3: 249
4: 1902
1089854405_1089854410 12 Left 1089854405 11:121529902-121529924 CCTTTTGTATTATCTAGATACAT 0: 1
1: 0
2: 2
3: 25
4: 306
Right 1089854410 11:121529937-121529959 TTTTATTTAGATTTTTTGGGGGG 0: 1
1: 0
2: 17
3: 249
4: 1902

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089854410 Original CRISPR TTTTATTTAGATTTTTTGGG GGG Intronic
Too many off-targets to display for this crispr