ID: 1089855145

View in Genome Browser
Species Human (GRCh38)
Location 11:121537083-121537105
Sequence AAGGGCCAAAGCATGATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089855141_1089855145 0 Left 1089855141 11:121537060-121537082 CCAGGTCTAGAGAGACCTTGAGC 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1089855145 11:121537083-121537105 AAGGGCCAAAGCATGATCAGTGG 0: 1
1: 0
2: 2
3: 25
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089855145 Original CRISPR AAGGGCCAAAGCATGATCAG TGG Intronic
901015062 1:6224532-6224554 AAGGGCCAAAGCATCCTATGAGG + Exonic
904527748 1:31146887-31146909 ATTGGCCAAAGCATGTCCAGAGG + Intergenic
904577188 1:31512573-31512595 AAGGGCCAAAGGGTGACCTGCGG - Intergenic
906274696 1:44507207-44507229 AAGGGCCAAAGCAGAAGAAGGGG - Intronic
908008241 1:59748888-59748910 AAAGACCAAGGCATGATTAGAGG + Intronic
909676282 1:78242150-78242172 AAAGACCAAAGCATGATTAGAGG + Intergenic
910011726 1:82471913-82471935 AAAGACCAAAGCATGATTATTGG - Intergenic
910238222 1:85058103-85058125 AAGGGCCAAAGCAAGAGCTGTGG - Intronic
910442886 1:87270825-87270847 AAGGGGGAAAGTATGAGCAGGGG - Intergenic
912231165 1:107794354-107794376 AAGGGCAAAAGCAAGATGAAGGG - Intronic
915614644 1:157027735-157027757 AAAGGCCAACCCAGGATCAGGGG - Intronic
916491410 1:165305514-165305536 CAGGGCCAAAGCAAGAAGAGGGG + Intronic
919134355 1:193489551-193489573 AAAGACCAAAGCATGATTAATGG + Intergenic
919825420 1:201500092-201500114 AAGGGCCACAGCATGGTGACTGG - Intronic
922754243 1:228085998-228086020 CAGGGCCAAGGCAGGATTAGAGG + Intronic
923088073 1:230716634-230716656 AAGAGAGAAAGCATGTTCAGGGG - Intergenic
923378346 1:233389558-233389580 AAAGACCAAGGCATGATTAGAGG + Intergenic
1065990605 10:31006226-31006248 AAAGACCAAAGCTTGATTAGAGG + Intronic
1066759355 10:38738551-38738573 CAGGGCCAAGGCAGGGTCAGGGG - Intergenic
1067847788 10:49737237-49737259 AAGGGCCTCAGCATGGACAGGGG - Intronic
1070457843 10:76634495-76634517 AAGGGCCAAGGCAAGATTAGTGG + Intergenic
1070679468 10:78438476-78438498 AAAGGACAATGCAGGATCAGAGG + Intergenic
1071218516 10:83435255-83435277 GATGGCATAAGCATGATCAGAGG - Intergenic
1071829445 10:89356996-89357018 AAAGACCAAGGCATGATTAGAGG - Intronic
1075162874 10:120040231-120040253 AAAGACCAAGGCATGATTAGAGG + Intergenic
1075248334 10:120844781-120844803 AAAAGCCAAAACATGATCATTGG + Intergenic
1076738488 10:132469024-132469046 AAGGGCCAGAGCTTGAACTGAGG - Intergenic
1078516378 11:12026174-12026196 AAAGGCCAAGGTATGATTAGAGG - Intergenic
1079053185 11:17181266-17181288 AAAGACCAAAACATGATTAGAGG - Intronic
1079708436 11:23651376-23651398 GAAGGCCAAACCATGATTAGAGG - Intergenic
1080591217 11:33724460-33724482 ACTAGCCAAAGCGTGATCAGAGG - Intronic
1080971054 11:37277425-37277447 AAGAGCCAAAGTAGGATCAGTGG - Intergenic
1081149974 11:39616066-39616088 AAAGGCCAAGACATGATTAGAGG + Intergenic
1081200108 11:40205000-40205022 AAGGGTAGAACCATGATCAGTGG - Intronic
1081472936 11:43393649-43393671 AAAAGCCAAGGCATGATCAGAGG - Intronic
1081475514 11:43426407-43426429 TATGGCCAATGCATGATCAAGGG - Intronic
1084641800 11:70430661-70430683 AGGGGCCAAAGGATGAACTGGGG - Intronic
1085965796 11:81524483-81524505 ACTTGCCAAAGCATGATCTGTGG + Intergenic
1087077799 11:94141944-94141966 AAGGGCCAAAACAGGATTAGGGG - Intronic
1088522431 11:110713268-110713290 AAAGGCCAAAGAATAATCAGAGG + Intergenic
1088980114 11:114854978-114855000 AAGGGCAAAACCAGGATCAGTGG - Intergenic
1089399894 11:118158240-118158262 AAGGGCAAAAGTGTGAGCAGAGG - Intergenic
1089606573 11:119644866-119644888 AGGGGGCAGAGCATGCTCAGAGG + Intronic
1089855145 11:121537083-121537105 AAGGGCCAAAGCATGATCAGTGG + Intronic
1090289375 11:125528564-125528586 AAAGACCAAAGCATCATTAGAGG + Intergenic
1091240566 11:134049540-134049562 AGGGGCCAAAGCATCACAAGGGG - Intergenic
1092463569 12:8707643-8707665 AAAGACCAAGGCATGATTAGAGG - Intronic
1092498492 12:9022601-9022623 TAAGACCAAGGCATGATCAGAGG + Intergenic
1092572957 12:9745286-9745308 AAGGACCAGAGCATGTTGAGGGG + Intergenic
1093700180 12:22211372-22211394 AAAGACCAAGGCATGATTAGAGG - Intronic
1094451276 12:30585360-30585382 AAAGACCAAATCATGATTAGAGG + Intergenic
1095389364 12:41687396-41687418 AAAGACCAAGGCATGATTAGAGG - Intergenic
1096368928 12:51052298-51052320 AAGGGCAAAAGCTTGATCAATGG - Intronic
1097181298 12:57173529-57173551 AAGGGCCAGAGCCTGCACAGAGG + Intronic
1097696030 12:62775731-62775753 CAGGGCCCAGGCATGCTCAGTGG - Intronic
1100187831 12:92156795-92156817 AAAGCCAAAAGCATGATTAGAGG + Intergenic
1101730718 12:107424930-107424952 CAGGGCCAAGGCAGGAGCAGAGG - Intronic
1104781077 12:131420953-131420975 AAAGGCCAAAGCTTAATCACGGG + Intergenic
1105940744 13:25145977-25145999 AAAGACCAAGGCATGATTAGAGG + Intergenic
1107720383 13:43242362-43242384 AAGGGCCAAAGCTAGAGAAGAGG - Intronic
1113510624 13:110851655-110851677 ATGGGACACAGCATGATGAGAGG + Intergenic
1114729729 14:24979207-24979229 CAAGGCCAAAACTTGATCAGAGG - Intronic
1114731872 14:25001482-25001504 AAGGACCAAGGCATGATTAGAGG + Intronic
1116363405 14:44029612-44029634 AAAGACCAAAGCATTATCAAAGG - Intergenic
1117117230 14:52526762-52526784 AAAGACCAAGGCATGATTAGAGG + Intronic
1117190774 14:53289058-53289080 AAGGACCAAGGCATGATTAGAGG + Intergenic
1118330245 14:64809281-64809303 AAAGGCCAAAGCTTATTCAGGGG + Intronic
1118337519 14:64866640-64866662 AAGGAACAAAACATGCTCAGAGG + Intronic
1119280226 14:73400623-73400645 AAAGACCAAGGCATGATAAGAGG + Intronic
1119572514 14:75688175-75688197 AAAGACCAAGGCATGATTAGAGG + Intronic
1120268320 14:82278376-82278398 CATGGCCAAAGCAGGATCAAGGG - Intergenic
1120953941 14:90065070-90065092 ATGGACCAAAACATGAACAGTGG - Intronic
1121595809 14:95161410-95161432 AAAGACCAAGGCAGGATCAGAGG + Intergenic
1122166259 14:99826518-99826540 AAGGGCCCAAGTTTGATCACCGG + Intronic
1122244467 14:100392449-100392471 AAGGGCCAAAGGAAGGGCAGAGG - Intronic
1122579096 14:102760597-102760619 AAGGGCTAAAGCATGAGCCATGG + Intergenic
1123415659 15:20093229-20093251 TAGGGCCAAAGCATTATTATTGG + Intergenic
1123524998 15:21100343-21100365 TAGGGCCAAAGCATTATTATTGG + Intergenic
1127957369 15:63864710-63864732 AGGGGCCAAAGCATGCTGTGCGG + Intergenic
1129100925 15:73262984-73263006 TAGTGACAAAGCAAGATCAGTGG + Intronic
1130156474 15:81354759-81354781 AAGGGCCAAAACATGTGTAGAGG - Intronic
1130583236 15:85157372-85157394 AAAGACCAAGGCATGATTAGAGG - Intergenic
1130858029 15:87858777-87858799 AAGGGCTGGAGCATGACCAGGGG + Intergenic
1132986981 16:2772328-2772350 AGGGGCCCCAGCATGGTCAGTGG - Intronic
1137227870 16:46532358-46532380 AAAGACCAAGGCATGATTAGAGG - Intergenic
1137416908 16:48290881-48290903 AAAGACCAAGGCATGATTAGAGG - Intronic
1137493253 16:48950600-48950622 TAGGGCCACAGAAAGATCAGTGG - Intergenic
1137997433 16:53233653-53233675 AAGGACAAAGGCATGATTAGAGG - Intronic
1139273026 16:65701006-65701028 AAAGGCCAAGGCATGATTAGAGG + Intergenic
1139491812 16:67290132-67290154 AAGGGCAAAGGAATGATCAAGGG - Intronic
1143908960 17:10231777-10231799 AAGGACCAAGGCAAGATTAGGGG - Intergenic
1146417384 17:32648527-32648549 AAAGACCAAGGCATGATTAGAGG + Intronic
1148073088 17:44920018-44920040 AAGGGCCCAAGCAGAACCAGCGG - Intergenic
1148180769 17:45603126-45603148 AAAGACCAAAGCAGGATTAGAGG + Intergenic
1148268134 17:46242800-46242822 AAAGACCAAAGCAGGATTAGAGG - Intergenic
1149698693 17:58637410-58637432 AAAGACCGAAGCATGATGAGAGG + Intronic
1149707791 17:58711448-58711470 AAGGACCAAAACATTAACAGTGG + Intronic
1151080716 17:71325394-71325416 AAAGACCAAGGCAGGATCAGAGG - Intergenic
1152164552 17:78693972-78693994 AAGAGAGAAAGCATGATCGGAGG - Intronic
1156754695 18:40508189-40508211 AAAGGCCAAAGAAAGATGAGAGG - Intergenic
1156988802 18:43381285-43381307 AAGGGCCAAAGTATGGTGAGGGG + Intergenic
1157079599 18:44508489-44508511 ACTGGCCAAAGAATGATCATTGG + Intergenic
1167806525 19:51790127-51790149 AAGTGCAAAAGTATGTTCAGGGG - Intronic
1168065606 19:53918217-53918239 AGGGGACAAATCTTGATCAGTGG + Intronic
927174849 2:20398659-20398681 AAAGCCCAAGGCATGATTAGAGG - Intergenic
927593133 2:24373977-24373999 AAAGACCAAGGCATGATTAGAGG + Intergenic
927967746 2:27282153-27282175 AAGGGCCCAAGCCAGAACAGGGG + Intergenic
928475920 2:31627620-31627642 AACAGCCAAAGCATGTTAAGAGG - Intergenic
928613662 2:33015817-33015839 AAGGCACAAAACATGACCAGAGG + Intronic
929279357 2:40061217-40061239 AAGGGTCAAAGACTGATCACAGG + Intergenic
929431438 2:41890748-41890770 AAAGACCAAGGCATGATTAGAGG + Intergenic
929825557 2:45306866-45306888 AAAGACCTCAGCATGATCAGAGG - Intergenic
930799949 2:55433633-55433655 AAAGACCAAAGCATGATTAGAGG + Intergenic
938884127 2:135625647-135625669 AAGGACAAAGGCATGTTCAGAGG + Intronic
940519563 2:154726974-154726996 AAAGGCATAAGAATGATCAGTGG + Intronic
942572702 2:177329815-177329837 AAAGACCAAGGCATGATTAGAGG - Intronic
944511442 2:200469989-200470011 AAGGCCCAAATCATGCTCTGCGG + Exonic
946975757 2:225148365-225148387 ATTGGCCAAAGCATGTTCATAGG - Intergenic
948530664 2:238601394-238601416 AAGGCCCAAAGGAGGATCAGAGG - Intergenic
1169043712 20:2518773-2518795 CAGAGCCAAACCATTATCAGTGG - Intronic
1169300822 20:4440697-4440719 AGGGTCCAAACCATCATCAGAGG + Intergenic
1170519407 20:17168603-17168625 AGGGGATAAAGCATGAACAGTGG - Intergenic
1170649949 20:18230054-18230076 AAGGGGCAAAGCAAGAACAAAGG - Intergenic
1172759127 20:37309623-37309645 ATGAGCCAAAACATCATCAGGGG - Intronic
1173666033 20:44763720-44763742 AGGGGCCAAACCAAGCTCAGAGG - Intronic
1173721470 20:45261725-45261747 AAGGGTGAAAGGATGCTCAGTGG + Intergenic
1174432040 20:50477363-50477385 AATGGCCAATGCATGATAAGTGG + Intergenic
1177176122 21:17702346-17702368 AATGACCAAGGCATGATTAGAGG - Intergenic
1177657061 21:24031338-24031360 AAGGGACTAAGCAAGATCATTGG + Intergenic
1178399534 21:32273379-32273401 AAGGACCAAGGCATGATTAGAGG - Intronic
1181947432 22:26529096-26529118 AAAGACCAAGGCATGATTAGAGG + Intronic
1182544425 22:31066250-31066272 TAGGGCCAAAGCATTATTATTGG - Intronic
1184332952 22:43837539-43837561 AAGGCCCAGAGCAGGCTCAGGGG + Intronic
1185053650 22:48566763-48566785 AAGGAGGAGAGCATGATCAGGGG - Intronic
949228017 3:1716508-1716530 AAAGACCAAGGCATGATTAGGGG - Intergenic
950822499 3:15775951-15775973 AAAGACCAAAGCATGATTAGAGG - Intronic
951487686 3:23232134-23232156 AAAGACCAAAGCATGATTAGAGG - Intronic
954980986 3:54745137-54745159 AAGTGCCAAGGCAAGATGAGTGG + Intronic
955015335 3:55064323-55064345 CAGTGCCACAGCATGTTCAGTGG - Intronic
957592849 3:82223624-82223646 AAGGGCCAAGTCATGTACAGAGG - Intergenic
958018228 3:87967673-87967695 AAGAGAGAAAGCATGAGCAGGGG - Intergenic
958851645 3:99333635-99333657 AAGGGAACAAGCATGATCAGAGG + Intergenic
959968137 3:112379393-112379415 AAGGCCCAAAGCATGGGTAGTGG - Intergenic
960803398 3:121560607-121560629 AAAGACCAAGGCATGATTAGAGG - Intergenic
962563434 3:136632717-136632739 AAGGCTAAAAGCATGGTCAGAGG + Intronic
962940476 3:140120584-140120606 AAAGGCCAAGGCAGGATCAGAGG - Intronic
966001274 3:174951977-174951999 AAGAGAAAAAGCATGTTCAGAGG - Intronic
966914524 3:184577525-184577547 AAGGGCCCCATCATGATCCGGGG - Intronic
967001985 3:185344599-185344621 AAGGACCAAAGGCTGATAAGGGG - Intronic
967603275 3:191414574-191414596 AAGGGCAAAATCAGGATCAGAGG + Intergenic
967826305 3:193880348-193880370 AGGGGTCAAAGATTGATCAGAGG + Intergenic
970912533 4:21293888-21293910 TAGGGCTAGATCATGATCAGAGG - Intronic
972666187 4:41167358-41167380 AAAGACCAAAGCATGTTTAGAGG - Intronic
973265688 4:48208100-48208122 AAGAGCCAAAGTCTGAGCAGAGG + Intronic
973602098 4:52552274-52552296 AAAGACCAAGGCATGATTAGAGG + Intergenic
977476253 4:97513450-97513472 AAAGACCAATGCATGATTAGAGG - Intronic
978522385 4:109629947-109629969 AAGGACCAAGGCAGGATTAGAGG - Intronic
980083273 4:128366895-128366917 AAGGGCCAAAGCAGAATCAGTGG - Intergenic
980234346 4:130085821-130085843 ATGGGACAGAGCATGGTCAGAGG + Intergenic
983490616 4:168385140-168385162 AAAGACCAAGGCATGATTAGAGG + Intronic
984176017 4:176417881-176417903 AAAGGCTACAGCAAGATCAGAGG - Intergenic
986120057 5:4826804-4826826 CAGGGCCAAAGCCTGCTCTGTGG + Intergenic
991114494 5:62938527-62938549 AAGGGCCAAGGAATTAACAGTGG - Intergenic
993545195 5:89203311-89203333 AAGGACCAAGCCATGATTAGAGG + Intergenic
993633661 5:90318083-90318105 AAAGACCAAGGCATGATTAGAGG - Intergenic
996316961 5:122170760-122170782 AATGACCAAGGCCTGATCAGAGG - Intronic
996392820 5:122980923-122980945 ATGGGACAAAGCATGAGCACCGG - Intronic
996623369 5:125538082-125538104 AAAGACCAAGGCATGATTAGAGG - Intergenic
996657688 5:125960923-125960945 AAGGCCCTAAGCATGAACTGAGG - Intergenic
1000434700 5:161194001-161194023 CAAGGCCAAATCATCATCAGGGG - Intergenic
1000884674 5:166737283-166737305 AAGGGTGAAACAATGATCAGAGG + Intergenic
1001036927 5:168303707-168303729 CATGGCCACAGCAGGATCAGAGG + Intronic
1001098055 5:168791216-168791238 AAGGGACAATTCATAATCAGGGG - Intronic
1002686776 5:181018158-181018180 AAGGGCAAAAGGATGATGTGGGG + Intergenic
1004132022 6:12929502-12929524 AAGGGCCAATGCATCATCTGAGG - Intronic
1006421075 6:33934502-33934524 AAAGACCAAGGCATGATTAGAGG - Intergenic
1006912390 6:37571873-37571895 GAGGGCCAATGCAAGGTCAGAGG - Intergenic
1007194398 6:40048063-40048085 AAAGACTAAAGCATGATTAGAGG - Intergenic
1007747514 6:44051979-44052001 AAGGGCCCAAGGATGCTTAGAGG - Intergenic
1009892314 6:69701453-69701475 AAAGGCAAAAGCATATTCAGTGG + Exonic
1010187518 6:73160411-73160433 GAGGGCCAAAGCCTGAGAAGAGG + Intronic
1011010692 6:82700755-82700777 AAGGGCCAAGGAAGGATAAGAGG + Intergenic
1012593966 6:101019091-101019113 AAGGCCCAATGCCTGATAAGAGG - Intergenic
1014833198 6:126126961-126126983 AAGGGCAATAGGATTATCAGAGG - Intergenic
1015539691 6:134301310-134301332 AAGGGCAAAAAGATGTTCAGAGG + Intronic
1016492937 6:144627273-144627295 AAAGGCCAAAGCATTGTCAAAGG + Intronic
1017015507 6:150096365-150096387 AAGGAGCAAAGCATGAGCTGGGG - Intergenic
1018216715 6:161535509-161535531 AAGGGCAAATGGATGATGAGCGG - Intronic
1019297368 7:285231-285253 TTGGGCCAAAGCATGCTTAGTGG + Intergenic
1023190348 7:37573970-37573992 AAGGGCCAAAGCAGAGTGAGAGG - Intergenic
1023910877 7:44555541-44555563 AAGGGTCAAAGCAAGGTCAAAGG + Intergenic
1026836463 7:73642902-73642924 AAAGACCAAGGCATGATTAGAGG - Intergenic
1027249351 7:76389482-76389504 AGGGGCCAAAGCAGGGACAGTGG - Exonic
1029937148 7:104437948-104437970 AAGGACCAAACCATGATTAAAGG - Intronic
1030913602 7:115284178-115284200 AAGGAAGAAAGCATGAGCAGTGG + Intergenic
1032893165 7:136221681-136221703 AAGGGACAAAGAATAATCAGTGG - Intergenic
1033094997 7:138423063-138423085 AAAAACCAAGGCATGATCAGAGG + Intergenic
1035966527 8:4198155-4198177 CAGTCCCGAAGCATGATCAGGGG + Intronic
1037058064 8:14469646-14469668 AAAGACCAAGGCATGATTAGAGG + Intronic
1037471342 8:19214517-19214539 AAGGCCCAAAGCATCACCATTGG + Intergenic
1037559155 8:20056256-20056278 AAAGACCAAGGCATGATTAGAGG - Intergenic
1041501738 8:58546384-58546406 TAGGCCCAAACCATGATCATAGG - Intergenic
1042321255 8:67478045-67478067 AAAGACCAAGGCATGATGAGAGG + Intronic
1042369704 8:67977626-67977648 AAAGGCCAAAGCATGATTAGAGG + Intronic
1044072338 8:87778130-87778152 CAGGGCCAAAGTATGAGCACTGG + Intergenic
1044553405 8:93536410-93536432 AAAGACCAAGGCATGATTAGAGG - Intergenic
1044666629 8:94639951-94639973 AATGCCAAAAGCATGAGCAGAGG + Intergenic
1046722403 8:117635593-117635615 CAGGGCCACATCATGGTCAGAGG + Intergenic
1047445024 8:124912111-124912133 AAAGACCAAGGCATGATTAGAGG + Intergenic
1047636824 8:126772834-126772856 AAGGACCAGAACAAGATCAGAGG - Intergenic
1048154885 8:131937010-131937032 AAAGACCAAGGCATGACCAGAGG - Intronic
1052798847 9:32948860-32948882 AAAGGCCAAGGCATGATTAGAGG - Intergenic
1053069061 9:35090250-35090272 AAAGGCCAGAGCAGGAGCAGTGG + Exonic
1057711642 9:97450980-97451002 AAAGACCAACGCATGATTAGAGG + Intronic
1061604582 9:131699193-131699215 AAGTGTCAAAGAATGAGCAGAGG - Intronic
1188702958 X:33288047-33288069 AAAGGCCACATCATCATCAGTGG - Intronic
1189717465 X:43881383-43881405 GTGGGCCAAAGCATGCCCAGGGG + Intronic
1195218414 X:102722579-102722601 AAAGACCAAGGCATGATTAGAGG - Intronic
1195382966 X:104288478-104288500 AAAGGCCAAGGCAGGATTAGAGG + Intergenic
1196184455 X:112731148-112731170 AAGGCTCAAAGCAAGATGAGGGG - Intergenic
1198378314 X:136061140-136061162 AAGGCCCAAAGCAGGCTCTGAGG + Intergenic
1201827190 Y:18258924-18258946 AAGGGCCAAAGCATTGTCTCTGG + Intergenic
1202085571 Y:21133152-21133174 AAAGACCAAAGCATGCTTAGAGG - Intergenic