ID: 1089855318

View in Genome Browser
Species Human (GRCh38)
Location 11:121538585-121538607
Sequence CTGTTTGCTCAAATACAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089855318_1089855321 -3 Left 1089855318 11:121538585-121538607 CCGTCCTGTATTTGAGCAAACAG 0: 1
1: 0
2: 0
3: 12
4: 213
Right 1089855321 11:121538605-121538627 CAGGTTTTTGAAACTACATGTGG 0: 1
1: 0
2: 0
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089855318 Original CRISPR CTGTTTGCTCAAATACAGGA CGG (reversed) Intronic
901348735 1:8572341-8572363 CTGTGTGCTAAAATGGAGGAAGG - Intronic
902070592 1:13732022-13732044 CAGTTTCCTCATATACAGAATGG - Intronic
904791133 1:33022256-33022278 CTGTTTCCTCATGTCCAGGATGG - Intronic
909549718 1:76884188-76884210 CTGTCTGCACAGACACAGGAGGG - Intronic
910984210 1:92989831-92989853 CTGTGTCCTCACATAGAGGAAGG + Intergenic
915384723 1:155479641-155479663 CTGTTTGCTCAAGAACAGCAAGG + Exonic
919800649 1:201352640-201352662 TTGTTGGCTAAAATACAGAAGGG + Intergenic
920374395 1:205499735-205499757 CTGTTTGCTCACCTAGAGAATGG - Intergenic
921370069 1:214413297-214413319 CTGTCTGCTTAAAGACTGGAGGG - Intronic
921562531 1:216675696-216675718 CTGTTTGAGTTAATACAGGATGG + Intronic
923151691 1:231239189-231239211 CTGTTTGTTCAAACACAAGAAGG + Intronic
923585507 1:235266461-235266483 CTGTTTGCTCAACAAAGGGATGG - Intronic
924209637 1:241751341-241751363 CTGTTTGCCCAGAAACTGGAAGG + Intronic
1063317825 10:5023354-5023376 ATGTTTGGCCAAATACAGGTTGG + Intronic
1066211157 10:33239899-33239921 CTATTTTCAAAAATACAGGAAGG - Intronic
1067410735 10:46062021-46062043 ATGTTTGCTGAATTAAAGGATGG + Intergenic
1068523115 10:58099338-58099360 CTGTTTTCTGAAATACAAAAGGG - Intergenic
1070855632 10:79606305-79606327 CTGCTAGCTCAAATACCTGAGGG - Intergenic
1071200810 10:83219541-83219563 CTGCTAGCTCAAATACCTGAGGG - Intergenic
1073832208 10:107397671-107397693 CTGGTTGCTCAATGAGAGGAAGG + Intergenic
1074012981 10:109503396-109503418 GTGTTTGTTCAAATATAGAAGGG - Intergenic
1074080726 10:110166221-110166243 CAGTTGGCTCAAAATCAGGAGGG + Intergenic
1074169936 10:110921812-110921834 CTGTTTCCTCAAAAACTGAAGGG - Intronic
1076346462 10:129782013-129782035 GTATTTGCTCAAAAACAGCAAGG + Intergenic
1078870705 11:15341882-15341904 ATGTTTGCTCAAATATTGGTGGG - Intergenic
1080213054 11:29809113-29809135 CAGTTTGCTCAAGTGCAGAAAGG - Intergenic
1080715226 11:34793645-34793667 CTATTTGCTCAACTACAAAACGG - Intergenic
1080726291 11:34902091-34902113 CTGTTAACTCAAATACCTGAGGG + Intronic
1081292488 11:41344009-41344031 TTGTTTGCTCAGATAATGGAAGG - Intronic
1081353108 11:42079790-42079812 CTATTTTCTTAAATACTGGAAGG + Intergenic
1082024862 11:47564949-47564971 CTGTTTGGTCAGATGAAGGAGGG + Intronic
1084935644 11:72585191-72585213 CTGTAGGCTCCAATACAGCAGGG - Intronic
1089855318 11:121538585-121538607 CTGTTTGCTCAAATACAGGACGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090874524 11:130776851-130776873 CTGTTTGTTCAGATGCACGAGGG - Intergenic
1091983674 12:4888519-4888541 CTGTATCCTCACATAGAGGAGGG - Intergenic
1092824704 12:12387762-12387784 CTATCTGCAGAAATACAGGATGG - Intronic
1094324613 12:29223307-29223329 GTGTTTGCTCAGAGAAAGGAAGG - Intronic
1095737812 12:45576753-45576775 CTACTTGCCCAGATACAGGAGGG + Intergenic
1096029102 12:48395919-48395941 CGGTGTGATCAAATATAGGAAGG + Intergenic
1096506319 12:52095808-52095830 CTGTTTCCTAATATGCAGGACGG - Intergenic
1099306151 12:80958916-80958938 TTGTTTGGTCACAAACAGGAAGG - Intronic
1099591898 12:84602886-84602908 ATGATAGCTCAGATACAGGATGG - Intergenic
1100010177 12:89943308-89943330 GTGTTTGCCAAAAGACAGGAAGG - Intergenic
1100400082 12:94221772-94221794 CTGTATTCTCACATACAGAAGGG + Intronic
1101076535 12:101134933-101134955 CTTTTTGCTCAAACCAAGGATGG - Intergenic
1102317766 12:111903782-111903804 CTGTTTCCTCATGTACAAGATGG - Intergenic
1103071950 12:117951731-117951753 CTATTTCCTCAACTAAAGGAGGG + Intronic
1105373614 13:19822431-19822453 TAGTTTGCTCAAATACAAAAGGG + Intergenic
1105705966 13:22967583-22967605 CTGTGTGCTGAGATACAGGGGGG - Intergenic
1105858867 13:24392567-24392589 CTGTGTGCTGAGATACAGGGGGG - Intergenic
1107636129 13:42394435-42394457 TTGTGTGCCTAAATACAGGAAGG + Intergenic
1110237121 13:73228433-73228455 CTGGTTATTCACATACAGGATGG - Intergenic
1111381509 13:87459506-87459528 TTGTTTGCTCAAAAATGGGAAGG + Intergenic
1113766731 13:112886131-112886153 CTGTCTGCTCAGACACAGGCTGG - Exonic
1115345667 14:32340823-32340845 CTGTGTGCTCACATAATGGAAGG + Intronic
1115872152 14:37816650-37816672 CTGATTGCTATAATATAGGAAGG - Intronic
1117575310 14:57091724-57091746 CTGGGTGCTGAAATACAGCAGGG + Intergenic
1117820111 14:59640082-59640104 CTCTTTCAGCAAATACAGGAGGG - Intronic
1119902468 14:78273063-78273085 CTGTGTGCTGTTATACAGGATGG - Intronic
1122157784 14:99760787-99760809 CTGTTTGCTCCATTATAAGATGG - Intronic
1122175025 14:99910773-99910795 CTGTTTGCTCACAGACAGCAGGG - Intronic
1122945021 14:105004284-105004306 CTGTTTGCTCAGAAACAAAAAGG + Intronic
1124355168 15:28989927-28989949 CTGATTTCTCAAAGCCAGGAAGG + Intronic
1126268358 15:46781722-46781744 CAGTTTACCCAAATACAGAAAGG - Intergenic
1126904991 15:53355358-53355380 CTGTTTGAACCAACACAGGAAGG - Intergenic
1127290402 15:57565434-57565456 CTGTTTGCTCACATCGCGGAGGG + Intergenic
1130402306 15:83568626-83568648 CTGTATGCTGAAATACGGGAAGG + Exonic
1130889702 15:88123239-88123261 CTGTTTCCTCAACTCCAGAATGG - Intronic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1132176467 15:99719505-99719527 CTATTTGTGCAAGTACAGGAAGG - Intronic
1135203738 16:20464031-20464053 TTCTTTGCTAAAATATAGGAAGG + Intronic
1135215264 16:20560905-20560927 TTCTTTGCTAAAATATAGGAAGG - Intronic
1135783368 16:25326069-25326091 CAGTTTACTCAACTGCAGGATGG - Intergenic
1135993324 16:27230544-27230566 CTGTTTCCTCATCTGCAGGATGG - Intronic
1137956207 16:52832651-52832673 CTGTGTGCTCAATTACTTGAAGG - Intergenic
1141044775 16:80706306-80706328 ATGTGAGCTCAAAAACAGGAGGG + Intronic
1143289596 17:5818880-5818902 CTGTTTTCCCAAACACAGAAGGG + Intronic
1144783800 17:17820870-17820892 ATGTTTGGGCAAATACCGGATGG - Intronic
1146685321 17:34837532-34837554 CTGTTTCCTCAATTACACAATGG + Intergenic
1153051031 18:903571-903593 CTTTTTCCTCAAATCCAGGCAGG + Intergenic
1155090562 18:22505000-22505022 CAGTTTCCTCAACTACAGAAAGG + Intergenic
1157312190 18:46560638-46560660 CTGTTTGCTAAGCTGCAGGATGG + Intronic
1157531999 18:48429036-48429058 CTGTTTTCTCAACTACAAAATGG + Intergenic
1157908167 18:51588548-51588570 CAGATTTCTCAAACACAGGAGGG - Intergenic
1158172319 18:54613725-54613747 CTGTTTCCTCACATAATGGAAGG - Intergenic
1163038192 19:14583677-14583699 CTGAGGGCTCAAATAGAGGAAGG + Intronic
1163038879 19:14587934-14587956 CTGAGGGCTCAAATAGAGGAAGG + Intronic
1164397696 19:27880232-27880254 CTGTTAACTCAAATACCTGAGGG + Intergenic
1164504107 19:28843963-28843985 CTGTTTGCTCATTTACAGAATGG + Intergenic
1165913874 19:39246362-39246384 CTGTTTCCTCACCTATAGGATGG - Intergenic
1165916993 19:39266566-39266588 CTGTTTCCTCACCTATAGGATGG + Intergenic
926132117 2:10310074-10310096 CTGTTTGCTCAGGTGCAGAAAGG + Intronic
926144393 2:10387833-10387855 CTGTTTGCTCAACTGCACGATGG + Intronic
930053206 2:47232972-47232994 CTGTTTGCTCAACTGCAAAATGG + Intergenic
930978057 2:57488647-57488669 CTGTTTCCTCAAGTGGAGGAAGG - Intergenic
931704472 2:64935921-64935943 CTGTTTGCTAAAAAACAGCCTGG + Intergenic
931931812 2:67146391-67146413 CTGGTTGCTCATATTCAGGGGGG - Intergenic
932321235 2:70823430-70823452 CTGTTTCCCCATACACAGGAAGG + Intergenic
935978892 2:108607148-108607170 CTGTGTCCTCACATGCAGGAAGG - Intronic
936608819 2:113981805-113981827 TTGTCAGCTCAAATACAGGATGG - Intergenic
936893001 2:117393977-117393999 CGGTTTGCTCATATACAAAATGG - Intergenic
937805979 2:126146170-126146192 CTGAATACTCAATTACAGGAGGG - Intergenic
939331522 2:140768680-140768702 CTGTTTGCTAAAATATCAGAAGG + Intronic
939552856 2:143636995-143637017 TTGTGTCCTCAAATACAAGAAGG + Intronic
940307242 2:152239684-152239706 CTGTGTCCTCACATACTGGAAGG - Intergenic
941879072 2:170463266-170463288 CTGTTTGGCCAAATACCTGAGGG - Intronic
943095461 2:183423004-183423026 CAGTTTGCTGAAATAAAGGCAGG + Intergenic
943551497 2:189345712-189345734 CTGGTTGTTCAAATAGAGAAGGG + Intergenic
945318066 2:208392156-208392178 CTGTTAACTCAAATACCTGAGGG - Intronic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
947268194 2:228305349-228305371 CTGTTAACTCAAATACCTGAGGG - Intergenic
1169007996 20:2224921-2224943 CTGTAAGCTCAATGACAGGAGGG + Intergenic
1169952919 20:11066593-11066615 CTGTTTGCAAGAATAAAGGAGGG - Intergenic
1172042219 20:32053275-32053297 CTGTTTTCACAACTGCAGGATGG + Intronic
1172185189 20:33027198-33027220 CTGTTTGCACACATACATGGTGG + Intergenic
1172250361 20:33475218-33475240 CTGTTTGCTCAAATTGTGCATGG - Intergenic
1174364643 20:50049090-50049112 CAGTTTCCTCAACTGCAGGATGG + Intergenic
1175053453 20:56176528-56176550 CTGTTTTCTCATCTGCAGGATGG - Intergenic
1175443442 20:59005982-59006004 CTGTATCCTCAAATACAGCCTGG + Intronic
1178217782 21:30621111-30621133 TTGTTTTCTCATATTCAGGATGG + Intergenic
1185104864 22:48861926-48861948 CTGTTTGCTCTGATGCAGGCTGG - Intergenic
949141783 3:642508-642530 CTGTTTATACAAAGACAGGATGG + Intergenic
949806032 3:7956823-7956845 CTGTGTCCTCACATAGAGGATGG + Intergenic
951749591 3:26019622-26019644 TTGTTTGTTCAATTAGAGGAAGG + Intergenic
953113041 3:39962152-39962174 CTGTTTGCCCATCTATAGGATGG + Intronic
955378880 3:58421202-58421224 CTTTGTGGTCACATACAGGAAGG - Intronic
955546009 3:60031038-60031060 CTATTTGCTGAACTACAAGATGG + Intronic
955732571 3:62002568-62002590 CTCTTTCTTGAAATACAGGAAGG - Intronic
955799418 3:62670567-62670589 CTGGTGACTCAAATACAGCAGGG - Intronic
959862814 3:111235203-111235225 CTGTGTCCTCAAATAGTGGAAGG + Intronic
960135317 3:114098422-114098444 CTGTTTCCTCAAATATAAAATGG - Intergenic
960372144 3:116853546-116853568 CTAAATGCTCAAATAGAGGAAGG - Intronic
963772732 3:149405313-149405335 CTGTTTCCTCACCTGCAGGATGG + Intergenic
964165389 3:153698283-153698305 CTATTTGCTCAGGTACAGAATGG - Intergenic
965134941 3:164752266-164752288 CTGACTACTCAAATACATGAAGG - Intergenic
965988867 3:174791188-174791210 CTGTTTGCCCACATATAAGAGGG - Intronic
966033578 3:175380618-175380640 TTGTTTTCTAAAATACAGCATGG - Intronic
967277943 3:187795062-187795084 CTCTTTGCTCAAACACTTGAAGG + Intergenic
968172741 3:196523508-196523530 CTGTTAACTCAAATACCTGAGGG + Intergenic
970356511 4:15258994-15259016 CTGTATGCACAAATGCATGAAGG - Intergenic
972364015 4:38356495-38356517 CTGTTTGCTGAAATATAATATGG + Intergenic
972649339 4:41001328-41001350 ATGTTTTCTCATATACATGATGG - Intronic
974326616 4:60422731-60422753 GTGTTTGCTGAAAAAAAGGAAGG + Intergenic
975536152 4:75453016-75453038 CTGATTGCCCAAGTAGAGGAGGG + Intergenic
976501506 4:85795555-85795577 CTGATTGCCAAAATACAAGAAGG - Intronic
978933623 4:114348645-114348667 CTTTTTGCCCAAAAACTGGAAGG + Intergenic
979136413 4:117117100-117117122 CTGTTAACTCAAATACACGAGGG - Intergenic
981230594 4:142350234-142350256 TTTTTTGCTCAAATAAAGCAAGG - Intronic
983412566 4:167418731-167418753 CTGTTAACTCAAATACCTGAGGG + Intergenic
984242927 4:177239414-177239436 CTGTGAGCTCAAATGCATGAAGG - Intergenic
986307403 5:6525751-6525773 TAGTTTTCTCAAATACAGGGAGG + Intergenic
988603186 5:32657910-32657932 CTCTTCGCTAAAATATAGGAAGG + Intergenic
990032504 5:51278654-51278676 CTTTTGGCTCACATTCAGGATGG + Intergenic
990824145 5:59878482-59878504 CTATTTTTTCAAATACAGGTGGG + Intronic
992130655 5:73689244-73689266 CTGTTTGCTCATTTTTAGGAAGG + Intronic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993890053 5:93462746-93462768 CTCTTTGCTAAAATATAGCAAGG - Intergenic
994176220 5:96714233-96714255 CTGGTTGCACAACTACAGGCAGG - Intronic
994774788 5:104027685-104027707 CTGCTAGCTCAAATACCTGAGGG + Intergenic
995597384 5:113762662-113762684 CTGTGTCCTCAAATAGAGGAAGG + Intergenic
998131296 5:139652390-139652412 CTCATTGCTCGAATCCAGGAAGG - Intronic
998457129 5:142281911-142281933 CTGTTTCCTCAACTACAAAATGG - Intergenic
1000332514 5:160217013-160217035 CTGTTTCCTCATCTACATGATGG + Intronic
1000464279 5:161556231-161556253 CTGTTTCCTCACATACAAAATGG - Intronic
1000657062 5:163891990-163892012 ATGTTTACAGAAATACAGGAGGG - Intergenic
1001538948 5:172523597-172523619 CTGTTTCTTCAAACCCAGGAAGG + Intergenic
1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG + Intronic
1011523463 6:88237205-88237227 ATGTTTGTTCAAATAGAGGCAGG - Intergenic
1012329100 6:97961858-97961880 CTGTTTGCTACAAAACAGCAAGG - Intergenic
1013688008 6:112608721-112608743 CTCTTTGCTAAAATACAACAAGG - Intergenic
1014198459 6:118583887-118583909 CTGTTAACTCAAATACCTGAGGG + Intronic
1014276805 6:119397825-119397847 CTGCTAGCTCAAATACCTGAGGG - Intergenic
1015651727 6:135469673-135469695 CAGGTTTGTCAAATACAGGATGG - Intronic
1016026637 6:139293913-139293935 CAGTTTGCTACAATCCAGGATGG - Intergenic
1017863300 6:158419985-158420007 CTTTTTTCTCAAACACAGAAGGG + Intronic
1019042999 6:169121521-169121543 CTGCTAGCTCAAATACCTGAGGG + Intergenic
1019498406 7:1352210-1352232 CTGTGTGCTCACCTACAGGTGGG - Intergenic
1023091763 7:36624471-36624493 CTCTTTGGTCAAACACTGGAGGG + Intronic
1023722589 7:43112209-43112231 GTGCTTGTGCAAATACAGGACGG + Intergenic
1026988423 7:74569343-74569365 CTGTTTGCTCAGTTACAAAATGG - Intronic
1027396581 7:77761640-77761662 CTGCTTGATAAAATACATGATGG - Intronic
1028662432 7:93295289-93295311 CTGTATCCTCAAATAGTGGAAGG + Intronic
1033537641 7:142327031-142327053 CTCTTTGCTCAAATATTGTAAGG + Intergenic
1034835402 7:154346987-154347009 GAGTTTGCTGAGATACAGGATGG - Intronic
1035902127 8:3468367-3468389 ATGTTTGCTCACATAAAAGAAGG + Intronic
1037630143 8:20648469-20648491 GTGTTAGCTCAAATACAGAGTGG + Intergenic
1038260311 8:25987289-25987311 CTGTGTGCTCAAACACTGGTTGG + Intronic
1038297113 8:26303948-26303970 CTGTATGTTCAAATACCAGATGG + Intronic
1038495837 8:28001762-28001784 CTGTGTTCTCAGATACATGAAGG + Intergenic
1038865793 8:31437534-31437556 CTGTTTGCTCTTATATGGGAAGG + Intergenic
1039836251 8:41258610-41258632 TTGTTTGCTTAAATAAAGGAAGG - Intergenic
1040605548 8:48927817-48927839 TGGTATGCTCACATACAGGAAGG - Intergenic
1041314580 8:56547595-56547617 CTGTGTCCTCAAATCCAGGAAGG - Intergenic
1043919187 8:85961813-85961835 AAGTTTGCCCAAATTCAGGATGG - Intergenic
1045531717 8:102991267-102991289 CTGTTTGCTCAAATGAAGTCTGG + Intergenic
1046358204 8:113115943-113115965 CTGTGTCCTCACATAGAGGAAGG - Intronic
1047208057 8:122819282-122819304 CTGTTTCCTCACCTACAGAATGG + Intronic
1049241467 8:141539477-141539499 CAGTTTTCTCAGACACAGGAGGG - Intergenic
1050769664 9:9181434-9181456 CTGTCTGCTCACACACAGGCAGG - Intronic
1051055970 9:12986515-12986537 CAGTTTTCTCAAATACAAAATGG - Intergenic
1051301797 9:15659475-15659497 TTGTTTGCTTAAATCTAGGAAGG + Intronic
1052097333 9:24399018-24399040 CTGCTTTCTTAAATAAAGGAAGG - Intergenic
1054980149 9:71196824-71196846 CTGTTTGCTCTAAAGCAGGATGG + Intronic
1057768277 9:97942824-97942846 CTGTTTAGTCAAAAACAAGACGG + Intronic
1058086587 9:100754114-100754136 CTGTTTGCTAAAACATAGCAAGG + Intergenic
1059467341 9:114477437-114477459 CTGTTTCTTGAAACACAGGAAGG - Intronic
1059614456 9:115933441-115933463 TTGTCTGCTCCATTACAGGAAGG + Intergenic
1059671256 9:116494495-116494517 CTTTTTGCAAAAAAACAGGAAGG - Intronic
1059923339 9:119181873-119181895 CAGTTTTCTCAACTACAGAATGG + Intronic
1061834807 9:133321790-133321812 TTGTTTTCTCAAACAAAGGAAGG - Intergenic
1187118664 X:16381371-16381393 CTATTTGATCATATACATGAAGG - Intergenic
1187186563 X:16992230-16992252 CTGTATCCTCACATACTGGAAGG - Intronic
1188502202 X:30839760-30839782 CTCTTTGAGAAAATACAGGAGGG - Intronic
1189887608 X:45564191-45564213 CTGAATGCTTAAATATAGGAAGG - Intergenic
1192555369 X:72084838-72084860 ATGTTTGCTAAAAGACAGAATGG + Intergenic
1192990777 X:76454009-76454031 CTGTGTGCTCAAACACTAGAGGG - Intergenic
1194260057 X:91684411-91684433 CTGTGTGCTTTAATACAAGAAGG + Intergenic
1195468206 X:105204392-105204414 CTGTTTGATCATTGACAGGAAGG - Intronic
1196991944 X:121339486-121339508 CTATATACTCAAATAAAGGAAGG + Intergenic
1197092481 X:122555674-122555696 CTCTTTGCTAAAATACAACAAGG - Intergenic
1198146808 X:133866080-133866102 CTTATTGCTCACATAGAGGAAGG - Intronic
1199913090 X:152308497-152308519 CTGTGTGCTCTAATCCTGGAGGG - Intronic
1200578752 Y:4923470-4923492 CTGTGTGCTTTAATACAAGAAGG + Intergenic
1200868500 Y:8072088-8072110 CTGTTTTCCCAAACACATGAAGG + Intergenic
1200869339 Y:8080386-8080408 CTGTTTTCCCAAACACATGAAGG - Intergenic