ID: 1089861312

View in Genome Browser
Species Human (GRCh38)
Location 11:121592230-121592252
Sequence CTGTTTGCACTGATGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089861312 Original CRISPR CTGTTTGCACTGATGGATGG TGG (reversed) Intronic
900498142 1:2985901-2985923 GTGGATGGACTGATGGATGGCGG - Intergenic
900883527 1:5399461-5399483 ATGTTTGGATAGATGGATGGTGG + Intergenic
902788378 1:18747634-18747656 CTATTTACAGGGATGGATGGGGG - Intronic
907623446 1:56005920-56005942 CTCTTTCCACTGATGGAAGGAGG + Intergenic
911507616 1:98773067-98773089 CTTTTTGCACTGTTGACTGGTGG + Intergenic
911596271 1:99801739-99801761 CAGCTTGAACTGAGGGATGGAGG - Intergenic
913251886 1:116918697-116918719 CAGTTAGCAGTGAAGGATGGAGG + Intronic
914926004 1:151888312-151888334 ATGTGTGCAATGATGGCTGGGGG - Exonic
915365112 1:155310696-155310718 CTTTTGGCTCTGATGGAAGGTGG + Intronic
916937449 1:169644386-169644408 CTGTTAACATTGATGGATGCTGG - Intergenic
917525827 1:175787699-175787721 CTTTTTGCCCTGCAGGATGGTGG - Intergenic
918237881 1:182597957-182597979 CTGTGAGCACTGAGGGAGGGAGG - Intergenic
919958804 1:202445182-202445204 GTGTTTGCACTGATTGGTGCAGG - Intronic
920513411 1:206567151-206567173 CTGTTTGCGCTGGAGGAAGGGGG + Intronic
921991942 1:221376369-221376391 TGTTCTGCACTGATGGATGGTGG - Intergenic
922007017 1:221541521-221541543 TGGTTGGCACTGATGCATGGAGG + Intergenic
922354782 1:224765400-224765422 CTGTTTCCACTGCTGGAAGGAGG + Intergenic
923412647 1:233725406-233725428 CTGTTTGCACTGGGGGAGGCTGG - Intergenic
1064193492 10:13227261-13227283 CCGTTTGCTCTGATGGACTGGGG - Intronic
1065984390 10:30935378-30935400 CTGTTTCCACTAATGGCTGGAGG + Intronic
1067151873 10:43742560-43742582 CTGCTTCCACTGATGGTGGGAGG + Intergenic
1068040377 10:51816820-51816842 CTGTTTTCCCTGTTGGCTGGAGG + Intronic
1069722244 10:70557232-70557254 CTGTGTGCTTTGAGGGATGGTGG + Intronic
1070700037 10:78595264-78595286 CAGTTTTGACTGATGGAGGGTGG + Intergenic
1071515284 10:86292916-86292938 CTGTGTGAAGAGATGGATGGGGG + Intronic
1071682379 10:87719012-87719034 CTGTTTGCAGAGGTAGATGGTGG - Intronic
1072610820 10:97016873-97016895 CTGTTTTCCCTGAAGGCTGGAGG + Intronic
1072825429 10:98601390-98601412 CTGATTAATCTGATGGATGGAGG - Intronic
1075228030 10:120647151-120647173 CTGTTTCCACTGATCAATGGTGG - Intergenic
1075729225 10:124626401-124626423 CCTTTTGCACTGAGGAATGGTGG - Intronic
1075932851 10:126314007-126314029 CTGTAGGCACTCACGGATGGAGG + Intronic
1076140365 10:128073550-128073572 GTGTTTGCAGTGATGGCAGGTGG - Intronic
1077475932 11:2790487-2790509 CTGTGTGCACAGCTGGATGCTGG - Intronic
1078552611 11:12290805-12290827 ATGTTCGCATTGATGTATGGGGG + Intronic
1084458040 11:69279736-69279758 CTGTGTGCATGGATGGCTGGTGG - Intergenic
1084458059 11:69279878-69279900 CTGTGTGCATGGATGGCTGGTGG - Intergenic
1084658808 11:70535373-70535395 CTGGTTAGACTGATGGATGATGG - Intronic
1084658818 11:70535435-70535457 ATGGTTGGACTGATGGATGATGG - Intronic
1086429216 11:86719119-86719141 ATGATTGGACGGATGGATGGTGG - Intergenic
1087280610 11:96205720-96205742 CTGATGGGACTGATGGCTGGAGG + Intronic
1087943393 11:104128411-104128433 TTGTTTGCTGTGATGAATGGAGG - Intronic
1089001988 11:115059856-115059878 CTGTTTGTACTGCTGGAGGCTGG - Intergenic
1089861312 11:121592230-121592252 CTGTTTGCACTGATGGATGGTGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091033526 11:132213168-132213190 CGGTGTGCACAGATGGATGAAGG + Intronic
1093681547 12:22008656-22008678 ATGTGTGCAATGATGGCTGGGGG + Intergenic
1094053539 12:26245903-26245925 GTGTTTGCACTGGTGGTTGTAGG - Intronic
1098051236 12:66455516-66455538 CTGTATGCACTCATGGAGGTAGG + Exonic
1098915716 12:76254947-76254969 CTCTTTCCCCTGATGGATGCTGG - Intergenic
1102912404 12:116727274-116727296 CTGATCGCACTGATATATGGAGG - Intronic
1103000835 12:117384311-117384333 ATGTCAGCACTGATGGATGGAGG - Intronic
1105476331 13:20730823-20730845 CTGGTTGCACTGCTGGCTGCGGG - Intronic
1110804117 13:79735579-79735601 CTGATTGCACTGATTGACAGTGG - Intergenic
1113549365 13:111180133-111180155 CTGTTGGCACTGGAGGGTGGTGG + Intronic
1115746275 14:36441006-36441028 ATATTTGCAATGATGGAGGGTGG - Intergenic
1115879105 14:37894782-37894804 CTATTTGCACTTATGGAGAGAGG + Intronic
1116657208 14:47667394-47667416 CTCTTCTCACTGATGGATTGTGG - Intronic
1122135904 14:99632915-99632937 CTATTTGCATGTATGGATGGGGG + Intergenic
1124864341 15:33474226-33474248 CTGGATGCATGGATGGATGGTGG + Intronic
1126345790 15:47692683-47692705 CTGTTTGCAGACATGGCTGGTGG + Intronic
1127088047 15:55442837-55442859 ATGTGTGCAATGATGGCTGGGGG - Intronic
1128552754 15:68608883-68608905 CTTGTTGAACGGATGGATGGAGG - Intronic
1131188344 15:90293960-90293982 CTGTTAGCACTGTAGGATTGAGG + Intronic
1131282482 15:91032836-91032858 CTGTTAGCACTGTAGGATTGAGG - Intergenic
1134880177 16:17739477-17739499 CAGGTTGCACTTATGGAGGGAGG - Intergenic
1135652043 16:24214696-24214718 GTGTTAGGACTGGTGGATGGCGG - Exonic
1135686194 16:24500151-24500173 CTCTTTGAACTGATGGATATGGG - Intergenic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1139086780 16:63596856-63596878 CTTTTTGCACTGACAGATGCAGG + Intergenic
1140691779 16:77491727-77491749 CTGATTGCCCTGCTGGCTGGTGG - Intergenic
1144571730 17:16404400-16404422 GTGTTTGCAGTGGTGGGTGGTGG + Intergenic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1148961060 17:51393236-51393258 CTGTATGCTATGATGAATGGTGG - Intergenic
1150235810 17:63591925-63591947 CTGTTCTGACTGAAGGATGGAGG + Exonic
1151244308 17:72782602-72782624 CTGTTTGAACTGGGAGATGGAGG + Intronic
1151806134 17:76406642-76406664 CTCTCTGCACTGCTGGTTGGTGG - Intronic
1152997749 18:424179-424201 CTGGCTGCACTGATGTAAGGCGG - Intronic
1155678961 18:28466202-28466224 CTGTTTACACTGGTGAATGAGGG - Intergenic
1156355831 18:36339276-36339298 CTGCTTGCATTCCTGGATGGTGG - Intronic
1157569262 18:48701531-48701553 CTGTGTGCACTGGGGGCTGGGGG - Intronic
1157624641 18:49041111-49041133 TTGTCTGCACTGCTGAATGGTGG + Intergenic
1159397300 18:67877076-67877098 CTGTTTGCACTGCAGGACTGTGG + Intergenic
1159504074 18:69311707-69311729 CTGTTTGAAATGATCGATTGGGG - Intergenic
1161353024 19:3804272-3804294 CTCCTGGCACTGATGGATGTGGG - Exonic
1167428042 19:49439679-49439701 GGGTTTGCTCTGATGGTTGGAGG - Intronic
1167464812 19:49645149-49645171 CTCCTGGCACTGAGGGATGGAGG + Intronic
1167810227 19:51823354-51823376 ATGTTTGCATTGAGTGATGGAGG + Intronic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
926586706 2:14694108-14694130 CTGTTTGCTCTTATGTATGATGG + Intergenic
926707042 2:15844238-15844260 CAGGTGGAACTGATGGATGGGGG + Intergenic
927599706 2:24430287-24430309 CTGTTTTCACTGATGGTTTAAGG + Intergenic
928115211 2:28541230-28541252 CTGTTTGCTAAGAGGGATGGTGG - Intronic
928480115 2:31675053-31675075 ATGTCTGCAGTGGTGGATGGGGG + Intergenic
928578457 2:32680564-32680586 CTGTGTGAAATGAGGGATGGGGG + Intronic
930020358 2:46998141-46998163 CTGTTTGCACTGAGGCTGGGAGG + Intronic
930169535 2:48236812-48236834 CTTTTTGAACTGCTGGTTGGGGG + Intergenic
933349689 2:81137531-81137553 GTGTCTGCAGTGATGGATGAGGG - Intergenic
933991111 2:87634605-87634627 ATGATGGCCCTGATGGATGGAGG + Intergenic
935250724 2:101257883-101257905 CAGATTGCACTGATGGACGTTGG + Exonic
935443117 2:103125109-103125131 CTATTTGCCCTGATGGACAGAGG + Intergenic
935666770 2:105518976-105518998 CTGTGTGCATTGATGGGTGTTGG - Intergenic
936302728 2:111316218-111316240 ATGATGGCCCTGATGGATGGAGG - Intergenic
941706105 2:168659726-168659748 CTCTTTGCAAAGTTGGATGGTGG + Intronic
947458503 2:230281574-230281596 GTGATTGCCCTGATGGATAGTGG - Intronic
947703731 2:232257507-232257529 CTGTTTGGAGTGACGGAGGGTGG - Intronic
1170025699 20:11887336-11887358 TTGTTTGTACTTATGCATGGTGG + Intergenic
1170850045 20:19996491-19996513 CTGTGTGAAGGGATGGATGGAGG + Intronic
1172185189 20:33027198-33027220 CTGTTTGCACACATACATGGTGG + Intergenic
1172299946 20:33842383-33842405 CTGGTTGCTCTGCTGGACGGAGG - Intronic
1172809513 20:37637276-37637298 CTCGTTGCTCTGGTGGATGGGGG + Intergenic
1174130971 20:48343120-48343142 CTCTGTGCACTGATGGAAGCTGG + Intergenic
1175539267 20:59738093-59738115 CTGCTTCCACTGGTGGAAGGTGG - Intronic
1177029036 21:15959099-15959121 CTGTTTTCACTTATGGATTCTGG + Intergenic
1179547119 21:42120215-42120237 GTGTTTGCACAGATTGCTGGTGG + Intronic
1180060110 21:45380659-45380681 GTGTGTGCACAGATGGATGCTGG - Intergenic
1180060130 21:45380793-45380815 GTGTGTGCACAGATGGATGCTGG - Intergenic
1181396260 22:22624740-22624762 CAGTTTACACTGATGCATTGAGG + Intergenic
1182754956 22:32672107-32672129 CTGCTGGCCATGATGGATGGGGG - Intronic
1185104864 22:48861926-48861948 CTGTTTGCTCTGATGCAGGCTGG - Intergenic
949454206 3:4221292-4221314 ATGTGGACACTGATGGATGGAGG + Intronic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950189390 3:10966247-10966269 CTGTTTGCACCCTTGGTTGGTGG - Intergenic
950834305 3:15904511-15904533 CTGTCTGCACTCATGAATGAAGG + Intergenic
953945287 3:47142049-47142071 CTGTATGAAATGATGGATAGTGG - Intronic
955009448 3:54999986-55000008 CTGTGTGCCCACATGGATGGTGG - Intronic
958745285 3:98126919-98126941 TTGTTTGCACTGTTGGATTTTGG - Intergenic
962241589 3:133755150-133755172 CTGTTTCCTCTGATGGATGGTGG + Intronic
964621577 3:158724478-158724500 CTGTTTGCTTTGATGGAGGATGG + Intronic
965601384 3:170457852-170457874 CTGCTGGTCCTGATGGATGGTGG + Intronic
966853786 3:184180476-184180498 CCTTTTGCACTGAGGGGTGGGGG + Intronic
967931349 3:194692777-194692799 CTGCTTGCACTCATGGCGGGAGG + Intergenic
968958770 4:3732203-3732225 CTGTTTGCACTGGTGCTCGGGGG + Intergenic
969627452 4:8314778-8314800 CTGTTTGAACATATGGCTGGAGG + Intergenic
971219996 4:24696227-24696249 CTGTTTGCATGGATAGATGCTGG + Intergenic
971293296 4:25365292-25365314 CTGGCTGCATAGATGGATGGAGG + Intronic
971803060 4:31317691-31317713 GTGTTTCCACTGATGGTGGGTGG + Intergenic
972018682 4:34280681-34280703 GTGTCTGCAGTGATGGATGAAGG + Intergenic
972369856 4:38412652-38412674 CTGTTTACTCAGGTGGATGGAGG + Intergenic
973982580 4:56318387-56318409 CTGTTTGTCCTGCTGGATGAGGG + Intronic
978415082 4:108466324-108466346 CTGCATGCACTGAAGCATGGTGG + Intergenic
980305980 4:131061837-131061859 GTGTTTGCATTTATGGATGTGGG + Intergenic
983672409 4:170253722-170253744 GTGTATGCACTGATGTATGTAGG + Intergenic
984588846 4:181594038-181594060 CTGTATTCACTGATCTATGGAGG - Intergenic
988078394 5:26382674-26382696 CTGTTTGCCCTGTTGGATTTTGG + Intergenic
988782149 5:34532156-34532178 CTGTTGGCAGTGGCGGATGGGGG + Intergenic
989758479 5:44984763-44984785 CAGTTTGCACTGAAGGAAGCAGG - Intergenic
991958035 5:72015133-72015155 CTGCCTGCACTGCTGGCTGGAGG - Intergenic
993956509 5:94241055-94241077 CTCTTTGCACAGATGGCTGGTGG + Intronic
998187453 5:139992484-139992506 CTTTTTGCACTGATGATAGGGGG + Intronic
999873675 5:155778473-155778495 CTTTTAGCACTGCTGTATGGGGG - Intergenic
1003266135 6:4566221-4566243 CTGTGTGCAGTGATGGAGAGTGG + Intergenic
1003274955 6:4642239-4642261 CTGGTTCCACTGATGGATGTGGG - Intergenic
1004885942 6:20051650-20051672 CTGCTGGCATTGATGGTTGGAGG + Intergenic
1004919881 6:20366623-20366645 CTGTTTGCTCTGATGGAGTGTGG - Intergenic
1007183904 6:39951081-39951103 GTGCTTGAAGTGATGGATGGGGG + Intergenic
1012930571 6:105311772-105311794 CTGTCAGCATTGATGGGTGGAGG - Intronic
1016211166 6:141535421-141535443 GTTTTTCCTCTGATGGATGGTGG + Intergenic
1017780904 6:157714553-157714575 GTGTCTACACTGATGGATGTTGG + Intronic
1018951730 6:168382775-168382797 CTGTGTCCACAGCTGGATGGGGG - Intergenic
1019710278 7:2515291-2515313 CTGGTTGAACTGATGGTGGGGGG - Intronic
1022177218 7:27883072-27883094 AAGTGTGCACTGATGGATGTTGG + Intronic
1024045053 7:45580291-45580313 CTGGTCGCACTGATGGAAAGTGG + Intronic
1029676573 7:102073845-102073867 CAGTTTAAATTGATGGATGGTGG + Intronic
1029819573 7:103132932-103132954 CTGTTTCCACAGATTGATTGGGG - Intronic
1033571354 7:142631953-142631975 CTGTTCACACTGCTGGAGGGTGG - Intergenic
1035576426 8:709824-709846 CTGTATGCATGGATGGATGATGG - Intronic
1037182561 8:16025066-16025088 CTGTATGCAATGAGGGAAGGTGG + Intergenic
1037609596 8:20464992-20465014 CTGTCTCCACTGGAGGATGGTGG - Intergenic
1038244414 8:25841439-25841461 CTGTTTGCTCTGTTGGATTTTGG - Intergenic
1038924086 8:32118416-32118438 CTGTTTGCACTCATGGTAGAAGG - Intronic
1038982144 8:32771593-32771615 ATGTTTGCAATGATGTTTGGAGG - Intergenic
1039170273 8:34737488-34737510 ATGTTTGCAAAGATGGATTGAGG - Intergenic
1041531836 8:58877550-58877572 CTGTTTGCACACATGGTTAGTGG + Intronic
1041691141 8:60688543-60688565 CTGGTTGCACTGATGGACAAAGG - Intronic
1045881685 8:107047996-107048018 CTGATTGCACTGTTGGATAAGGG + Intergenic
1047315539 8:123729954-123729976 TTGTGTGCACAGGTGGATGGTGG - Intronic
1047643294 8:126843804-126843826 CAGTTTGCACAGATGGAAGCAGG - Intergenic
1048033454 8:130654431-130654453 CTGTTTGTAGTGAGGGATGCTGG + Intergenic
1048503838 8:135003038-135003060 CTGATTCCACTGATGTAAGGAGG - Intergenic
1048506961 8:135030426-135030448 GTGTTTGCAATGGTAGATGGGGG + Intergenic
1048842393 8:138577343-138577365 CTGTCCTCACTGCTGGATGGAGG + Intergenic
1049632683 8:143667074-143667096 GTGTTTGCACAGAGGGAGGGAGG - Intergenic
1051053470 9:12956839-12956861 CTGTTTGCATTGAATGATAGGGG + Intergenic
1051678715 9:19584430-19584452 ATTTGTGCTCTGATGGATGGTGG + Intronic
1056383227 9:86074545-86074567 GTGTCTGCACTGAAGGAAGGCGG + Intronic
1062357112 9:136170202-136170224 CTGTTTGGGATGATGGATCGTGG + Intergenic
1188171862 X:26937651-26937673 TTGTTTGGATTGAGGGATGGAGG - Intergenic
1188655627 X:32691757-32691779 CAGTGTCCACTGATGGATGAGGG + Intronic
1189551652 X:42099585-42099607 ATTTTTGCACTGGTGGATTGGGG + Intergenic
1189774186 X:44455486-44455508 CTGAGTGTACTGAGGGATGGAGG + Intergenic
1191686118 X:63892558-63892580 ATGTTTGCACTGATGGGGGTAGG - Intergenic
1194930444 X:99881072-99881094 CTGTTTGCACTGAAGAATCCAGG + Intergenic
1197424374 X:126277131-126277153 CTGTGTTCATTGATGGATGAAGG + Intergenic
1197446495 X:126556243-126556265 CTGTTTGTAGTGGTGGAGGGTGG + Intergenic
1197527860 X:127583849-127583871 CTGCTTCTACTGGTGGATGGGGG + Intergenic
1199116606 X:143999997-144000019 TTGTTTGCCCTGATGGGTGTTGG - Intergenic
1200291113 X:154874949-154874971 GTGTGTCCATTGATGGATGGAGG + Intronic
1201266033 Y:12207615-12207637 CAGTGTCCACTGATGGATGATGG - Intergenic
1201293526 Y:12444975-12444997 CTGTTTACACTGGTGGCTGAAGG + Intergenic