ID: 1089861351

View in Genome Browser
Species Human (GRCh38)
Location 11:121592619-121592641
Sequence TTGCTTCCATAGCCATTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089861349_1089861351 16 Left 1089861349 11:121592580-121592602 CCATATATTGCTTCCTAATTATT 0: 1
1: 0
2: 1
3: 39
4: 379
Right 1089861351 11:121592619-121592641 TTGCTTCCATAGCCATTGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 154
1089861350_1089861351 3 Left 1089861350 11:121592593-121592615 CCTAATTATTTCATGCGTGTTGA 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1089861351 11:121592619-121592641 TTGCTTCCATAGCCATTGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089861351 Original CRISPR TTGCTTCCATAGCCATTGTG TGG Intronic
906215598 1:44036363-44036385 CTGCTTACATAGCCATTAAGTGG - Intergenic
907721561 1:56977214-56977236 TTGCTGCCAATGCCATTATGTGG + Intergenic
907928487 1:58977074-58977096 TCTCTTTTATAGCCATTGTGAGG - Intergenic
908041307 1:60116644-60116666 ATACTTCCTTAACCATTGTGGGG - Intergenic
908323277 1:62998994-62999016 TTGCTTCCGTAGCCCTTGGCAGG - Intergenic
909894907 1:81056353-81056375 TTTCTTCCATAAGCATTGAGTGG + Intergenic
911186596 1:94910713-94910735 TTCCTTCCAGGGCCACTGTGAGG + Intronic
911417946 1:97599448-97599470 TTGCTTTCATAGCTATGGTAGGG + Intronic
912602525 1:110951561-110951583 TTGCTTCCATGGCCAATCTAAGG - Exonic
914671805 1:149876581-149876603 TAACTTCCATAGCCCTTGTATGG + Intronic
917169242 1:172151757-172151779 TTGCATCCATAGGCATTTTCAGG + Intronic
921786752 1:219240197-219240219 TTACTTCCATTGCCATTCTTAGG - Intergenic
924022910 1:239803356-239803378 TTACTTCCTTGGCTATTGTGGGG + Intronic
1063580547 10:7302359-7302381 TTGCTTCAATAGCAATGCTGTGG + Intronic
1066307903 10:34164820-34164842 TTATTTCCATAGTCATTTTGGGG + Intronic
1067988048 10:51174420-51174442 TTGATTACATAGACATTGTAAGG - Intronic
1069263299 10:66427729-66427751 TTCCTTCCAGAGCCCTTGTCGGG - Intronic
1072497889 10:95980699-95980721 TTGCTGCAAAAGCCAATGTGTGG - Intronic
1072932136 10:99674883-99674905 TTTCTTCCAATGCAATTGTGTGG - Intronic
1074314837 10:112351708-112351730 TTACTACCAGAGCCATTGAGTGG + Intergenic
1075661779 10:124202110-124202132 TTGCTTCCAATTCCGTTGTGGGG - Intergenic
1077239979 11:1505538-1505560 TTGCTTCAAAAGCCATTTTTGGG - Intergenic
1080840471 11:35979093-35979115 TTGCTTTCATAAACATGGTGAGG + Intronic
1088580957 11:111316170-111316192 TTGGTTCCATAGGAATTTTGGGG - Intergenic
1089861351 11:121592619-121592641 TTGCTTCCATAGCCATTGTGTGG + Intronic
1091650021 12:2302921-2302943 TTGCTGCCTTGGCCATGGTGAGG + Intronic
1092925968 12:13272582-13272604 TGGCTCCCATAACCATAGTGGGG - Intergenic
1093315795 12:17648100-17648122 TTTTTTCCATACCCATTTTGAGG + Intergenic
1096353715 12:50922044-50922066 TTACTTACATAGACATTTTGGGG - Intergenic
1097682166 12:62658985-62659007 TTGCTCCCATAACCAATGTTGGG - Intronic
1098155553 12:67594104-67594126 TTGCTTCAAGAGGGATTGTGTGG + Intergenic
1101434373 12:104652596-104652618 TTGCTTTCCCAGCCATGGTGAGG + Intronic
1102826504 12:115951627-115951649 TTGTTCCCATAGCCATTTTGAGG + Intergenic
1103029713 12:117603017-117603039 TTGCTTCCTTGGCCATTATGTGG + Intronic
1105286679 13:19009723-19009745 CTGCTTCCCTCCCCATTGTGAGG - Intergenic
1105351952 13:19623862-19623884 TTGCTTCCATGTTCATTTTGGGG + Intergenic
1106742180 13:32656326-32656348 TTGATTCCATAGACATTTTAAGG + Intronic
1106909756 13:34450999-34451021 TTACTCCCAGAGCCACTGTGAGG + Intergenic
1114204611 14:20557125-20557147 TTGCTTCCATTTCCTGTGTGGGG + Intronic
1118318425 14:64739298-64739320 TTCCTTCTAGAGCCATTGTGGGG - Intronic
1120333211 14:83120262-83120284 TTGCTTACATAGTCATCATGTGG + Intergenic
1124991947 15:34683503-34683525 TTGTATCCATAACCATTCTGTGG + Intergenic
1127797930 15:62454391-62454413 TTGCTTCCAGACCCATTGGAGGG + Intronic
1130007783 15:80117849-80117871 ATGCTGCTATAGCAATTGTGGGG - Intronic
1133780564 16:8935898-8935920 TAACTTCCATAGCGATTGGGAGG - Intronic
1137719168 16:50617741-50617763 TTTCTTCCACAGCCACTGTATGG + Intronic
1143225699 17:5300835-5300857 TTGCTTACAGAGTCATTGGGAGG + Intronic
1143679592 17:8466679-8466701 TGGCTTCCGTGGCCAGTGTGCGG + Intronic
1144417559 17:15066041-15066063 TTCCTTCCAGAGCATTTGTGAGG + Intergenic
1147060585 17:37874390-37874412 TTGTTTCAATAGACATTGTAGGG - Intergenic
1148409871 17:47456870-47456892 TTGTTTCAATAGACATTGTAGGG - Intergenic
1148993101 17:51683436-51683458 CTGCTTCCAGATCCATTGTGTGG + Intronic
1149465653 17:56876999-56877021 CTGTGTACATAGCCATTGTGAGG - Intergenic
1152015642 17:77748693-77748715 TTGGTTCCATCTCCATTCTGAGG + Intergenic
1152479713 17:80542368-80542390 TTGCTCCCATAACCAATGTTGGG - Intergenic
1152794324 17:82299403-82299425 TTCTTTCCACAGCAATTGTGGGG - Intergenic
1152872999 17:82768308-82768330 TGGCTTTCATAGGCATTGGGTGG + Intronic
1153546787 18:6215349-6215371 TTGAATGCATAGCCTTTGTGTGG - Intronic
1156345276 18:36251599-36251621 TTGCTTCCAGATCCAATCTGAGG - Intronic
1158637499 18:59174336-59174358 TTGCTTCCATAGCAATTTGGTGG - Intergenic
1159133503 18:64308891-64308913 TTGTTTCCATATCCATTATTAGG + Intergenic
1159473714 18:68890061-68890083 TTGCTTCCATATCCTTTCAGTGG + Intronic
1160770373 19:828372-828394 CTGCTTCCAAAGCCAGTGAGGGG + Exonic
1161238897 19:3211038-3211060 ATGCTTCCAGAACCAGTGTGTGG + Intergenic
1161740312 19:6017352-6017374 TTGCGTCCATGCCCAGTGTGGGG - Intronic
1161885045 19:6988163-6988185 TAGCTTCCTTACCCATTGAGGGG + Intergenic
926211530 2:10874384-10874406 TTGCTCCCATAACCAATGTTGGG + Intergenic
928581867 2:32716561-32716583 TTTCTTCCTTAGTCATAGTGTGG - Intronic
935465145 2:103388109-103388131 CTGCTTACATATCCAATGTGTGG - Intergenic
936045026 2:109180703-109180725 TTCCTTCCACCACCATTGTGAGG + Intronic
937112799 2:119379571-119379593 TTGCCTCCTGGGCCATTGTGTGG - Intergenic
938381812 2:130840558-130840580 TGGCTTCCTGAGCCATGGTGTGG - Intronic
938927776 2:136060313-136060335 TTTGTTTCATAGCCATCGTGTGG - Intergenic
939181512 2:138808424-138808446 TTCCTTCCATAGATATTGTGAGG + Intergenic
940897574 2:159095381-159095403 TTGCTGACATGCCCATTGTGGGG + Intronic
941759455 2:169225385-169225407 TTGCTTCTATATCTATGGTGGGG - Exonic
944273652 2:197810454-197810476 TTAATTACATAGCCATTGAGGGG + Intronic
946102335 2:217336594-217336616 ATGATTCCATACCCTTTGTGTGG + Intronic
946338089 2:219051566-219051588 GTGCTTCAGTAGCCACTGTGAGG + Intergenic
948239089 2:236413880-236413902 TTGTTTCTAAAGCCAATGTGAGG + Intronic
1168770092 20:408934-408956 TGGCTTCCAGAGCCATCTTGGGG + Intronic
1177439936 21:21109998-21110020 TTGCCTCCAAAGCCGTTGTAGGG + Intronic
1180625885 22:17193068-17193090 TTGCTCCCATAACCACTGTTGGG - Intronic
1180914745 22:19478477-19478499 TTGCTTCCAAAGGGATTGTAGGG + Intronic
1181011484 22:20043482-20043504 TTGCTTCCCTAGCCCCTGCGTGG + Intronic
1183998438 22:41653992-41654014 TTCTTTCCAAAGCCATTGTTTGG + Intronic
1184305331 22:43596067-43596089 TTGCTTCTATATTCATTGTGAGG - Intronic
949314389 3:2735697-2735719 TTGCATACATAGTCATTTTGAGG + Intronic
949778474 3:7658387-7658409 TTGGTTCCATTGCCATTTTTTGG + Intronic
950011284 3:9725860-9725882 GAGCTTCCACAGCCAGTGTGTGG - Intronic
950411274 3:12839439-12839461 TTGCTTCCATAACCAATGTTGGG + Exonic
950552633 3:13675904-13675926 GTGCTTTCACAGCCATTTTGGGG - Intergenic
953030433 3:39176406-39176428 TGGCTTTCATAGCCATTGGAGGG - Intergenic
953075977 3:39570685-39570707 CTGCCTCCAGAGACATTGTGAGG + Intergenic
953091637 3:39732827-39732849 TTGGCTCCATAGGCCTTGTGGGG + Intergenic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
956714028 3:72062702-72062724 TTGCTTCCATCATGATTGTGAGG - Intergenic
960484204 3:118231204-118231226 TTACTAAAATAGCCATTGTGAGG + Intergenic
960674552 3:120181734-120181756 GTGCTACCACAGCCATTGTCTGG + Intronic
963684407 3:148416972-148416994 TTGCCTCCATAACTGTTGTGGGG + Intergenic
965761776 3:172085606-172085628 TTGCCTCCATGGCCCTTGTTAGG + Intronic
966243698 3:177782343-177782365 TTCCTTCCAGGGCCGTTGTGAGG + Intergenic
974920697 4:68235555-68235577 TTTGTTCCACAGCCATTGTAAGG + Intronic
976420343 4:84835450-84835472 TTGCTTACATAATCATTTTGGGG + Intronic
978182895 4:105822693-105822715 TTCCTTCAATAGCCATTGAAAGG - Intronic
978799196 4:112738837-112738859 TTGCTCCCATAACCAATGTTGGG - Intergenic
980221246 4:129919037-129919059 TTGCTTCCATTTCCACCGTGAGG + Intergenic
984422311 4:179539510-179539532 TTTCTTCCACTGCCAATGTGTGG - Intergenic
986956897 5:13162383-13162405 TTGATTCCATAGACATTGCAAGG - Intergenic
988937548 5:36102251-36102273 TACCTTACAAAGCCATTGTGAGG - Exonic
990492280 5:56314301-56314323 TTGCTTCCATAAGCATGGAGAGG + Intergenic
990744935 5:58950119-58950141 CTGCCTCCATATCCAATGTGGGG + Intergenic
991456056 5:66805873-66805895 TTGCTTCCATTGCCAATCTCAGG + Intronic
995906062 5:117125038-117125060 TTTCTTCAATATTCATTGTGAGG + Intergenic
997434074 5:133861588-133861610 GTGCTGCCAAAGCCATGGTGGGG - Intergenic
998575415 5:143310343-143310365 TTGCCTACATTGCCATTATGAGG + Intronic
998806292 5:145920432-145920454 TACCTTCCACAGTCATTGTGAGG - Intergenic
999135375 5:149315450-149315472 TTACTTCCAGTGGCATTGTGGGG - Intronic
1000450404 5:161379624-161379646 CTGCTTCTATAGCCAGAGTGTGG - Intronic
1001412193 5:171519710-171519732 TTGCTTCCATGGCCACTTTCTGG - Intergenic
1005272267 6:24179153-24179175 CAGCTTCCTTAGGCATTGTGGGG - Intronic
1006497097 6:34431639-34431661 TTCCTTCCTTAGTCATTGTTGGG - Intergenic
1008095373 6:47334446-47334468 TTGCTTCCTTCTCCATTGTCTGG - Intergenic
1009394015 6:63176486-63176508 TTGTTTCCATAGCCGCTTTGAGG + Intergenic
1010369717 6:75093191-75093213 TTGCCTTCATAGACATTCTGGGG - Intronic
1010955524 6:82086907-82086929 TTTCTTTCAGAGACATTGTGTGG + Intergenic
1013011342 6:106123340-106123362 TTGATTCCAGAGCTGTTGTGTGG + Intergenic
1015036968 6:128667711-128667733 TTGCTTCCACACCCACAGTGGGG + Intergenic
1017129964 6:151099691-151099713 TTGCTCCCATAACCAGTGTTGGG - Intronic
1018472166 6:164106706-164106728 TTGCTTCCTAAGCCCTGGTGTGG + Intergenic
1018699943 6:166418518-166418540 TTCCTTCCTTAGCAATTGGGTGG + Intronic
1021247093 7:18276669-18276691 TTACTTCCATAGACAGTGAGTGG + Intronic
1021336199 7:19405555-19405577 TTCCTTCCATGGCAATTTTGTGG - Intergenic
1021510992 7:21432530-21432552 TTTTTCCCTTAGCCATTGTGAGG + Intronic
1022679092 7:32527172-32527194 TTGCCTCCTGAGCTATTGTGTGG + Intronic
1023899964 7:44468062-44468084 TTGCTCCCATAACCAATGTTGGG - Intronic
1027758304 7:82245179-82245201 TTGCTTGCACAGCAATTCTGTGG + Intronic
1028113724 7:86973671-86973693 TTGCTTCCAGGTCCTTTGTGAGG - Intronic
1028971539 7:96864352-96864374 TCTCTCCCACAGCCATTGTGTGG + Intergenic
1029028728 7:97446393-97446415 GTGCTTACATAGTCATTGGGCGG + Intergenic
1035038861 7:155913209-155913231 TTGCTTACACGGTCATTGTGAGG + Intergenic
1035819760 8:2578869-2578891 TTTCTTCCCCTGCCATTGTGTGG + Intergenic
1038973606 8:32666654-32666676 TTGCTGTCTTAGCCATTGTTAGG + Intronic
1042126300 8:65540587-65540609 TTTATTACATAGCCATTTTGAGG - Intergenic
1042796903 8:72674024-72674046 TACCTTCCATGGTCATTGTGGGG + Intronic
1043035076 8:75186748-75186770 CTGATTCCAGAGCCAGTGTGGGG - Intergenic
1045679388 8:104642353-104642375 TTGCCTCAATAGATATTGTGAGG - Intronic
1045769214 8:105715084-105715106 TTGATTCCATAGCCAATCTACGG - Intronic
1046244297 8:111538626-111538648 TTGCTTCCCTTTCCATTATGAGG + Intergenic
1046545546 8:115645305-115645327 GTGATTCCATAGCCACTGTAGGG - Intronic
1048281603 8:133109666-133109688 TTGCTCCCATAACCATCCTGAGG - Intronic
1048311524 8:133326162-133326184 TTGCTCCCATAACCAATGTTGGG - Intergenic
1048768701 8:137871366-137871388 TTGTTTCCATAGGCATTAGGTGG + Intergenic
1051080321 9:13286488-13286510 TTGCTTTTATAGGCATTTTGAGG + Intergenic
1052990784 9:34518389-34518411 TTGCCTCCCTGGCCATGGTGGGG - Intronic
1053442647 9:38128711-38128733 TTTCTTTCATAGACATTCTGAGG + Intergenic
1060527380 9:124328175-124328197 TTGGTTACATACCCAGTGTGTGG - Intronic
1189615068 X:42774719-42774741 TGGCTCCCATTGCCTTTGTGTGG + Intergenic
1193997825 X:88388421-88388443 TTCCTTCCATGCCCATTTTGGGG - Intergenic
1195120050 X:101740225-101740247 GTGCTTCCATAGTCTTTCTGGGG + Intergenic
1196262955 X:113607090-113607112 TTTCTTCTATGGCCATTCTGTGG - Intergenic
1198774585 X:140166256-140166278 ATGCTATCATAGCCATTTTGGGG - Intergenic
1199541638 X:148964450-148964472 TTCCTTCCTTTTCCATTGTGTGG - Intronic