ID: 1089866952

View in Genome Browser
Species Human (GRCh38)
Location 11:121640799-121640821
Sequence CGCAAAGGAGGCTTTGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089866941_1089866952 17 Left 1089866941 11:121640759-121640781 CCATACTTGTGGATTAAGGTGGG No data
Right 1089866952 11:121640799-121640821 CGCAAAGGAGGCTTTGGGATGGG No data
1089866939_1089866952 18 Left 1089866939 11:121640758-121640780 CCCATACTTGTGGATTAAGGTGG No data
Right 1089866952 11:121640799-121640821 CGCAAAGGAGGCTTTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089866952 Original CRISPR CGCAAAGGAGGCTTTGGGAT GGG Intergenic